Description :
From Genome Similarity Track
Location :
Scaffold_3231:1458- 2627
Sequence
1169 bases(100 bases per row)
GTTGTGGCTTTCTGGCAGTCCGAAGAATAGATGCCACATCCAGCCCTCGTAGTCAGCAACAGCTTCGAGCACTATAGTCGGTTTCTTGTCTTTCCCGTGT
GCTGGCCTGCCCAGGCCTTCGGACAGTTCTTCCACTTCCAACGAGTACAGTCAAGACTGCCGAGTACTCCCGGAAAGCCTCTCGCCTCACCGATCTGCAT
CAAACGCGCGAGGTCTGCAGCTGTTGGCGCTCGCAAGTACTCATCGCCAAACGCATTCACAACGGCAACATAGAAGCGCTTCAAGCTTTCCAGCGCAGTC
GCTTCAGCCGCTCTCACGTACTCACCACAGGCGTCTGCAGGCGTTCCGTATACCAGCTGGCGTATCGCTGCTGTCGCTTTCTGGATTGTCGAGAGTCCCG
GACGACCAGCAGCGTCTGGACGCTGGATGAAGTAGCGATCTTGCACCACGATGCTCTCGAGGACAAGGGCGAAGCCAGCGCGACTCATGCGGAAGCGGCG
CCGAAAGTGCTCATCCAGGAAGACCGGACGCGCCACCAAGTAGTCATGAATGATATTCTTGTGGCCGTCGCTGTGGCCTCTCTCCACGTTCGGACGGCGG
CCCGGCCGGGATCCTCCGTGCTTCTTCTTCTTGCGCAACTTCTTGTACGCCGCCACAGCAAGCGCAGTATGCTGGGCGACGTCGACCCACGCGTCGTCTT
CGTTGTCTTCGAAGAGCGCAACCAGGACCTCGGATAGCTCCAATGCGGTGAAGTTGTGAGAAATGGCATTGATAAAACAATAAGCATTTGATCACACGCT
GTGCAGAACATGGATAAAATACGCCGTGCAGACTAATAAAATTTGATACGATCAATTGGTGTGTGGGCACACGCTGTGCAGACTAATCTTATGAGCAAAG
AGCATGTAAGCACCCGCGATGCGGACTAAAGTCTGTCTCAGTTAATAACGACCTCGAAAAAGATTATTTTTTAAATCAAATTTTTGAAGTTAAAGACTAC
CGTTTTCGTACAAATCACACGTGGCCGCTGATTGACAAAAAACAAAGAACATCGTTGAAAAAATCGGAGCTCAATCTGTGCTGTCAGTCAAAAGATACAA
GCGAGCAAAGCCAAGCACCATGAAAAATGAGCGTGAACGGCAGGCCCGCGCGCGCAAACTTCGTCGCTT