Description :
From Genome Similarity Track
Location :
Scaffold_148:145700- 147972
Sequence
2272 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGAGACCGTTTACGTAGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGTTGTTCAACGCAAACTCAACAACAGGGAGCATG
GATTCCAACGCTTAGGCGTATTAGCGTAAACACTGCGCAAAATGTCATTAATGACGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGC
TGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAACTTCCCAGTGAAGCGGGGATCTCTATCAGAGACAACTGATACTGGCAAG
CCATGTTGTCGAAACACACGGTCGATAAACATCTTCGCTGTACCTTCGGCATCAACAGAGTCCGGTACTGCCGCTAGATGAGCCATCTTGCTCAATCGGT
CAACAAATACCACAATACCAGTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATAATCATGGACTCCCAACACCCAGTGGGTACAGGCAG
ACTATCCAGCGGCGCCGCTGCATGTGCTGAGGGTTTAACCCGTTGACACGTTTCACACGTACGCACATAGTTGCTCACCCACTTGTATAGTTTGGGCCAC
CAATAAGCCTGGCTCACTGAGCTATAGGTCTTTTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAGGATTAGATACTTCAACTCAT
CATCATGAGGGACAGCGATACGAGGGTTATCCTCGATATCTGTGCGATAGCACAACAGGCCATTATCGATAGAATATCGATGTAGCCTCGCACGTAAACG
TGCCGACAATTCTATGTCCGAGTCTTTAAACGACTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGAATAAG
TCATTGACTGACGATGAAAGCGTAGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCATCAGCCAAAGCATTTTGCTTTCCTGGATTACACTTC
ACTTCGAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGTCATTCTCTGAGAGAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGCATGATCTGTAT
AGATCACAAATGGCTTTGAGCCAAGCAGATATACTCTAAATTTGACTAGAGCGTACTTCATGGCAAGTAGCTCTTTGTCATGAACTGTGTAGTTCTTTTC
AGCAGCTTTGAGCTGTCGAGATTCAAATGCAATGGCGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACTGCTTATGGCAAGGTCAGATGCGTCA
CAGACGACACTGAAAGGCCGATCAGGATCGGGCAAAGCCAATATTGGCGCATGAAGGAAACTTTTTTTAACTGCTTGAAAAGCATCCTGTTCGGTGTTAC
CCCAACACCAATTCACATCCTTCTTAATGAGATTGGATAATGGCCGAGCCATATCTGCGTAATTCGCGCTATACTTATGCAAGTAATTGGCAAGGCCAAG
CCACTTACGTAGATCTTTCTGGTTCTTTGGAACCGGCCAATCGACTATGGCTCTTACCTTAGCGGGATCCGCTCGAAGGCCTCGCTTCCCAATGAAGCAC
CCCAGAAAGGGAATCTCCTGCACCAAAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGCGCATGCACTCGATCACCGCTCGTAAATGATCAATG
TGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGAACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTGCG
TCACCAGACGATTAATAGTAGCCGGTGCATTTGACAGCCCTTGTGACATAACGAGCCACTCCCAGAGCATACCAATCGAGGTACTAACCGCTTTTACCGG
AATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCAACTACGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAGCACCCTTT
CAGGGGATTGGTGTCTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAGCGTGCACAATACGCCACTTACCATTAGACTTTTTTACAGAAAATGTAG
ATGTGGGATGGGGAGACTTACTCTCCCGCACCATTTCCGCCGCGTGCTTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCCTTAGGTAAAGGCTA
CTGCCGTGTTACGCACTATTTAGTTCCTGGAACTAAGTCAATTTCATTACGTACACCTCTATCGGGAGGTAA