Description :
From Genome Similarity Track
Location :
Scaffold_2080:1457- 5476
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2080-fgenesh-gene-0.0Pyruvate dehydrogenase E1 alpha subunit
Pytar_ATCC12531maker-par_contig_2080-fgenesh-gene-0.2Adherance factor

Sequence
4019 bases(100 bases per row)
ACGATGCTCTTCCGCCAGACCGCCCAGCGCCTCGCCGCGCCCGTCGCGCGCCTCTCGACTGCGCGCTCGTTCAGCGCCGCCAGCGGCAACGTCACGTTCG
ATGTGGCCACGCCCTTCAAGCTCCACAACCTCGAGAGCGGTCCGTCCGAGACGGTCGAGACGAACCGCGACGAGCTGCTCAGCTACTACCGCCTCATGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGTACACGATGCGCCGCATGGAGATCACGTGCGACAACGAGTACAAGGCCCG
CAACATTCGCGGCTTTTGCCACTTGTACGATGGCCAGGAGGCCGTCGCGACCGGCGTCGAGGCCGCGCTCAGCCGCACCGACTCGTGGATCACGTCGTAC
CGCAACCACTGCACGATGCTCGCGCGTGGCGGCACGGTCCAGGAAGTGCTGAGTGAGCTCTTCGGCATGGCCTCGGGGGCCACCGGCGGCAAGGGCGGCT
CGATGCACTTCTACCGCAAGAAGGAGAACTTTTACGGCGGCCAGGGCATTGTCGGTGCGCAGGTACCCGTCGGCGCCGGCCTCGCTTTCGCCAGCAAGTA
CAACCACAATGGCGAAGGCCTGATGCCGTGCGCCATCACCATGTACGGTGACGGTGCCGCCAACCAGGGCCAGATCTGGGAGGCTGCCAACATGGCCGCG
CTCTGGAAGCTGCCGGCCATTTTCTGCATTGAAAACAACCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AACTTTGACTACTACACCATGGGCAACAAGATCCCCGGTGTCTGGTGCGACGGCATGGACGTGCTGGCCGTGCGCGAGTGCACCAAGTTCTTGAAGCAGT
GGTGCGGCGAGGGCAACGGTCCCATCTACGTCGAGATGAGCACGTACCGTTACCACGGCCACTCGATGTCGGACCCGGGTGTGACGTACCGTAACCGTGA
AGAGATCTCGCAGATGCGCGCGTCCCGCGACCCGATCGAGAGCGTCAAGAAGCGTCTGCTCGAGGCCAACCTCGCGACCGCCGAAGAGATCAAGGAGCTC
GAGAAGGAAGTGCGTGCCGAAGTCGTCAAGGCCACGAAGGAGGCCAAGGCGAGCGGCCGTCCCGCCGAAGCGATGGCCTTCCAGGACGTTTACACGGACG
GCAATGGCCACAACGAGTTCCCGCCATTCATCCGTCTGCCCGACTACACGAAGAGCCTGTACAACGGCAAGCCGCGCGCTTAAACCGGAGGCGTCGTCTT
GGCCTCTCTGCTGTGAAAATGATGGATGGTAAATGAGCTGCAAACCCACGCACGCGAGGTTAGCGTGTCTCGTGTGTTTCCCCTTGTAATAGACCATCCG
ATTTTCTGCACCAAGGAGATCGGACTGCGTAGTGCGGTCGGTATGTGGCAGGCAGGCAGGACTCAAAGGGCAATTCCATACGTTGACATTTGAAGGATTT
CATGTTACTTTTGACGACGCGGCTGATAATACGGAGTATGGGGACGAGCGTGTCGATCCGACGTCGGGGTGGCCTTGCGATCCGTGCCTGCCCGCGCTCC
TCCCTCTCTCTGGGTGGCACTGTACTCGGTGGTTCTTGGTTCTTCTTTTTCTTCTTTTTCTTCTCTCTCTCTCTCTGACATACGCACACGGTCTGGACGG
GCGTCTCTTACTCCATCTCCTCGCCCCGTGGTCAACGCGTGCGCGGAGCACTCGTTCGCGTGTGCTTTGGGTACCGACGGGAGTCGTAGACGTCGGCGTC
ATGCTGGTACTGGTTACTGGACGGCGTGGGCACATCGGCGAGCCCACGCGAGAGGAGTTGGATCTGGTGGTCCACTTCCATCTCCACAGATGCTCCTTTG
CCGTACAGCACGGCGCCGTTCTTTGTCTGGCACACGGCGCGGCGCACGCGCGACGGAGGGATAATGCCAATGTTGCAATCAACGAACTCGTTCTGGCCCG
CCGCACCGTAGCTACTGTACGTGATCTGCGGGTGCTGATGAGGGTCCTGGTTGTCCGGTGCCCCAGTGTCGTCGTGTTCCTCCATGCGCAACGCCGCGAC
GCGGTGATGCACCTTGCGGCGAACGTGCTGCGCGAGGTTGTGGGTGCTCTTGGCCTGGTCGATGAGATCCGGCGCACGCTCGGCAGCCTCCTTGAAACGG
GAGCGCGACTCGCTGTTGACGCCAGGCACAGCATAGAGCTGCTCATAGCTGCTGTAGTCAACCACGAGCGTCTTCTTGCGGTTCTGTCCGCCTCCGCTGC
GGTGGCGCTGGCGCCTCTTTTCGGTCGCCGTCTGCGGGCTGAAGGGCTCCACGGCAACGAACCATTCACGAGCAGGCGGACTGGACAGCGATGTGGGGGA
CCCGGTCGAAGTTGACGATGTCGAGAGGTACTGCAGCTTCTCCATGGTCTCCTCGTCCGACTCGGACGAGTGGCTGCTGCTCGCATCGTCACCGGCACCC
ATGCGGCTTTGGTGCTGGCGGAACGCCTCGATCGAGATGGCCAAGTCGGCGGGGCTGCCGCGCCTCTTGGCCTGGAAAAGCGAGCCGCCCTTGATGATGC
CGTCACTAAAGGACCGCGTGGGAAAGCTGGCTTTTGGGATCGACACAGCTTCGGTCGAGTCCGAGAACGTCTTGTACTCGATGAGGCGGCTTCGAACGGG
GTCCAACACGTCGTCCAGCGAGCGTCGCTTGCCGTGCGTGAAGCTTTGTGTGCGGCAAATCGACGCGGCGTTGCTTTGTTGATTGTTGCTCCCACAGCGG
ATGCTGCTCACGTCCGAGTCCACGGTGATGGTCGACGCCGTACGTGACGCTGGTGACGCCACGTTTGATGCGGCACCACAGCCAACGAGAATGCCGCCGT
CCTGGGGCGCCGGCGTCTTGGACGATCGCCGCACGGCGATCACACAGGCCGTGCACACGCGCAACTGACGCTCGCCGACATCAGGCACGATCGTCGTGCG
CACAGTGGAGCAGTTGCTACAAATGACTTCGCCGCACTTGAGGCAGTTGTACTTGCGGCGCAGCACACAGAAATTCTTCTCGCACACGTGGCAGTGGTCC
TGCTCGCGCATGGCGAGCACTTGCTGCGGTAGCACAATCTCTTCCTTGTTGGCGCGGTAGTTTTCGATGTACTTGGCGATGCCCGTGACGCACATCTCGA
CGTGCTGCTGGATGGCCGAGTTGGCGGCCCAGGCCGGGAGGTCCCCGTTCTTGTCAAAGTTGCACGAGTACGTGAGCCGCAGCTCGCCTTGCTTCTTGGT
CGTGTGGTACATGAAGCCCATGAGTGGCACAAGGTCGCGGGTGTACTTGGTCGAGTCGATCGTTACGGGCCAGTGCGCGGTCGTGAGCGACGGCACGTCC
ACCGACTCCATGATCCGGAACGCGATCTTCTGGCCTTGGTCGTCTTCGATCATGTCGACGTACTCCAGAATCATGAAGTCGCGGTCCTTGCCAAAGCGGC
TCGAGCTCTTGAACGCAGCCCACTTGAGCGCGAGGTACCGGTACGGGTTCTGCTCGGTCGGCTCGACGATAGTCTGGAGCACGGCACCGTCCAGAAAGTC
GGACGAGAGCATTCCCATCATCTTCTTGTAGCTCTCCGTGGAGCTCGTGATCATGGACCGCGCGACGTCTTCAATGTCCGAGTTGAACTTGTACACGGCG
TGGACGTTGCACGGCACATTGTCGTTGGCCGTGTCGGCGCGGAAGAGCGAGATGCCGTGCTTCTCGTGGACGAGCGACCAGGGGACGCCGCCGAGCAGGT
CCGTGGCCATGAGCAGGTCCTCGGTCATGGCCTTGGCCACGGCCGTGAGCCGCTCCTTCTCCTTGAGGTCCATGGCCTCGATGACGTCGAGACTGCTGTC
GGACGCACTGCTGGAGCTCATGCTGAGTGGTGGAAGGAGGAGTCGTTGGCTTCAGACGGAAGGATGGAGACTGTCGCCTGGGGATATGGACGGAAGCGTC
GCGAGCGTGGGGGGATCGC