Description :
From Genome Similarity Track
Location :
Scaffold_587:1457- 3522
Transcript NameFunction/comments
Phymu_g11002conserved hypothetical protein

Sequence
2065 bases(100 bases per row)
TTGCCGTACTGCTTTCGCGCACTGCCTTGGCGTTCAGCCACTTACTGTGCAACGCTACAAGCGCCGCGTCCGTGAAGGGAACATAGCCCCTAAAGAGCAC
GGCAACAAGCTGAATAAGAACGCGTCCACCATCGATGCAGTGTGGCTCGTGCGACGGTTCAAGGAGTTTGCTTCTGAGGTTGGTGAGGTGGTTTCCGTGC
GGGTACGCATGcagaagaccaaggacgGTGTTGTGAACAAAACCTATAGTCGCGAAGACTACACTCTTCTACCAGCTACGTTCACTTGGGACGTTCTCTA
CGATGAGATGCACAAGTACGTTGCTAAAGGTCTACGCGTCAATGAGCCCGCCTACAACGTTTAGGAAGCTTCTGTCCCTCCACTGCCCCACCATCAAAAT
CCGGTCTGCGCAGTCAAACGTGTGCGATCTGTGCGCAGTTTACCAGACACGTATGCGCCACGGAGCTACAGCAGAGCAAACCGAAGAGCTGGGTCAACAC
ACAGAGACCGCACGTCGAATGAGGTAAGAAGCTGTTATTATCATTTTGAAATATCTCTGGACACTAATATCAATTTGATTTACTATGAACATTAGACGGG
CgtacaagaaggacaaaGGCGATGTACACGCGGAGGACGAAGCAAACAGAGATTTGGCTGTGCTCGTCATGGACTTCTCGCAGAATTTAACTGTTCCGTC
GGTCacatcgacgccatcgcagTGGTATTTTTGCTCGTTGCTCGCTGTGAGGGTTTTTGGCATTTTGCTTTTTACGAGAATGAAGGGACGCAGACCAACT
ATGTCTACGACGAGTTCGCAAGCGGAAAAGGCAGCGACCAAATAAactcgatgctgcagcacttcatTCGTTctgtgctgcttccagcCGGAAAGAAACG
ACTCATCGTCTACGCCGACAACTGCTCTGGCCAGAACAAGAATAACCATGTCATCAAGTTCTTACTGGCACTAATCCACATGGGAGTCTTTGAGCGGGTC
GACTACACGTTCTTTGTGAAAGGCCACACAAAAACTCCTGTGATCGAGGCTTTGGTCACATTCGCAAGCACGTAGCTCGTCAAGACTGCTGGATTTTGGA
TGATGTCGTCTCTGCTGTGAACGATTCGGCTAGTACCAACACTACGGTGCACATTTCGCGTGGAAATAATACGTTTTTCAAGAGCTACAAACCACTGGTT
GCTGAGCTGTACAAGACGTTGGTGGGCGTACAACAGTACCAGATATTTACCGCAGTTGAGGACTAACCTGGCGTTGTATTGTGTCGCAAAGGGCCTGACG
ACAAAccggtgctgcaggatctACGGCGCAAAGTTGATGAAATTCGTACGGAGCCTGAGAAAATGTCACGAATGTTCACACACTTCCTGGAAGACTTGAG
CCCGCCCCCTCGCAATGCTGAAAAGATGCTAGAGCTACACGCCAAGATCCGGCCCTACGTCCCTGAAGAGCATCAAGGGAATTGGATCTACGCTGCGCca
agtgagcagcagcaggtggacgcAAAGACAGCCAAAAAGGCTCGTCGAGAGCACCGAGCCGCCATGGCGGCCAGTGCCAAGGCCAATCAGGATCGACGTG
GCAGGTAGGCTGACAACGAAGCTCCTCCTACGCCGAAGAAGTCACGCAAATGAAGAACTGCGACTCTGTATCAGGAAGTAAAACTTGAAATGGCGCTCAA
CAAAATGATGCTTGTGTCCAGGGTGAAAACAAAATGATACTTACCTCGTCCATTGTCACTATTCTGAAATATCGAACGCAATTGAATATTTGGCAATGTT
CTGATACGAATCTGAAGAAATGAGCTTCACCATTGGCTCCGCAGTGCAATTTTACGTCTAGCTAGCTaacaaaaaaaataacaTTTTTTGTCTGGGAAGG
GAGACAATTTTTTTGCCGGACCACTGCTCGGTCAAGTTTTGGTTCCTGGAGCTCTACATGGTCTCAAAATGAAGAGGAGATACGCTTCTTGCCAGTGGTA
CCCTTAAATCGCGATTCGTACTTAGGTTCATtagtatttttttgtttgaCGCAGTCTCAAATACG