Description :
From Genome Similarity Track
Location :
Scaffold_871:1457- 3332
Transcript NameFunction/comments
g12185.t1hypothetical protein
g12186.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae

Sequence
1875 bases(100 bases per row)
CTCCTTCCTTAAGTGGGGGAGGATATCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGAC
GACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACATCAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGG
GGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGTCGTAATTCGGTTTGTCCAGGACGCGATAGCAGCTTCTGTCGATCGACAGAAGCTGAA
CGCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTATGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTC
GGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCAATCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCCTGC
ACTAAACATTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGGGCGCGGCGACGCGCTTC
AAGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCA
GAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAGGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCGCCCCCCCACC
CCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTATTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTC
GTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGCCCTGATGGAGAACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACTG
CCACCTCTGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGAATATCCGCAGCACTAGAAGACGCCTGCG
CCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTATCCGTTGACGTCCCGCTCGGTAATGCGTACTGCTCCGGGGTAGCA
GTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCG
TAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGCGGTTCTTGTTGAAGTTTTCAACAAAGTCACTCCAACTCTGACAAAGTGCCTGCCACT
CGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTCATCGGATC
AAAGTGCAATCGCTTCGCGACGTCATCGTCAACGATGGCGTTACACGAATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCTGATC
TCAAACTGATACGGCATCCATGGCTCGCGCACTGGCACAGTGCGCGAGGCCACAGCAGCAGCGGATGGAGTGGAGTCATCTCCATCCCGCGGAGTCGTCA
AAGTTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCCCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGTAGACCCACATT
GGGGTCAGTGTGGCCCGGAGACAAGATGTCCTTGTCTCCTTCGAGTTCCCCCCTCCTCGACTTCGCTTGTATAGT