Description :
From Genome Similarity Track
Location :
Scaffold_62:1457- 2942
Sequence
1485 bases(100 bases per row)
AAGGCACCTCCTTGCACAAAGGATGACCTACACTCACTCATCCGGTATGCCTACAGCACGGCGTCCGTTGCCCCGGGCTACGAAGACGCTGCGCTGGCGT
ATCTGATGTGGCACTGTTTTGGGAGATCCTCGGATCTAGGATACGTCAGTAAGCAGCACTTCACACTGTCAGCTGACAACGTATTTTAGATACGAATGCT
ACGGGTGAAAACGGCGGAGAAGCAAGGCCCCACCCTCATCCCTGATCGCGAAGACTTCTTGACTTGCCCGCTGCATCCATTGGCTGTCGCCCTGGTGATG
CAGAAGGCGCTGTGCGTGTCCTTGCTGAGTCAGCTTCGGTGCTGGCCCCGCCACGCCGACTCCCGACGCTGTAGCCCCCCCCCCCTGCTGGAGATACTGC
AGGGCTGACCGGGCTCAGCCCATACTCGCTGGACATTGATCCCTGTCAGCTGCGACTTCGCCATCTGTGCATGCCGCTCGTGCTGCTATTTCCGGGCTTC
GTTAAACTTTCGCAGCTGCTTTAGCACTTAAGAGCACCAGCTATTCTCGCGGAAAAGACGGTGTACAAGCTTACGTGAATCGGTTTTGAAGAGGGTGGCG
GAGCCGGCTGGAGCGACATGTACCTTGACGCCGCACTCGATTCGCAGAGGAAGCGCCCAGCACGCTAATGGAGACGATCGTCTCACAGCACAATGGGTTT
TTGGCAGGGGGGCTTGGGATATGACCGGACGAATAAATTCTTTGCCTGCGTCTTCAACACGTTCCGTGAAGACAGAAAAGTAGCACGCGTCCTGAGTGGC
TGGAAGGCTGACGAAGCTCCCGTTGTTGCTGACGTTGGGATGCTTGATCGTGGTGCTCAGGAGCGCTTGGTGCGATTGCAGAAACTGCTGTTTGGCTGCT
GTACGGGACTAGAGGACGCCAGGCCCAACGTGAGTACCACGTTCATTGGAGTATTGACTGCGTACCTGATCAAGTATCTCCCGCAAGTGGGACGTCGGCG
CCGAGGAGTCCGTTCGTCGTCCGCGTCGAGGAGTGCTTGAGTGCGACCGGAATCACGGTAGCTGATATGCTTGCTTGGTTATCGGCTTTGGCAGCTATCA
CTTCTGTACCTGCTGAAAAATATAAAGAGGCAGAAAAGAAGATCGACCACAGCAACTCGGGGTGTCATCATGCTGCTGTCATTAGCCAGCTTATAGAGAA
CAATCGATTACTGGTAGCTCGGCTTGTCGTGCTTGAGGTCGCCGCCTTGAAGCGCCCAGCATCACACGGATTAACTGGACCAGAAACACAAGAACCGAGA
GCGCTAGTTAAAGAACCACCAGCGAAGCGGAGAAAGAAACCCACAGCCAACCTGTCATCGATGTAGCTTGAGTGGTACACTCAGCTTCCGCGCATCTGAT
TCCCGAACGACCGCCAGAAGAAGTTCGAGTACGCCTTGGGGTGGCGTACAGGAAGATCCTTCTTAATGACGGGTTCCACCTTCGA