Description :
From Genome Similarity Track
Location :
Scaffold_3593:1457- 2707
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3593-fgenesh-gene-0.0Gene of unknown function

Sequence
1250 bases(100 bases per row)
GGTCGAGGGTGACCGCGTCGACGACGACTCGAGTTTCGCCTGACCGGAGAGCCATACCAGCTAGGTAATCCGCAGCGCCGTTGATCTCGCGCTTCACATG
CACCAGGTCGAGCGATCGAAAGGCAACCCGGAGCTCGTTGAAGCGGTTCAACAGCAATTCCAGGTGCGGCTGGTCGCAACCGATCACTCCTTGNNNNNNN
NNNGCACTGCTGGACGACAATGCGTGAGTCGCCAACGACGACCAGCTTATCGGTCGCGCNNNNNNNNNNAGCTCGTTGTCGTGGTCGACCAGTCCGCCTG
GTGTGCTGACGAGCTCGAGGCCTTGCAACATGCCGGTATACTCGGCTTGGTTCACTGTGACACCTTCCAAGTAGATCGACTTCGCGTACACCGGGTCCCA
GCCAGGCAACTTCCAGAGCACAAAACTCGCGCTGCCGGCGTTTGACTTCAGTTTGGCGGCTCCGTCGAAACTGANNNNNNNNNNTACGTACCCAGTGTAT
TCAGCGTCCAGCATTTCGATGCTGACCAGCAGTGGCTTCACGCGCATGGCCTTGGTCGGAATCAGCTCGGCTGCAACCTGGTCGAGCTTCTCTCGGGGCG
TGATACTCGCAGCTATCAGTGCCGCCAGCCCGTCCTCGTCTCGATCCAGCTTGTGCACTCTCAGTGACCACGGAGACAGCAATGCGGCCCATTGCAATGT
ACGCCCTTGGACTGACTTTGAGTTCAGAACCCACTTCAACGTCGAGTACCGCGTATAGACGACCAGCTCTTGACCAGCGACCAGCGTGTAGAAGACGTTT
AACACTCGCAATACAGCCAGCACTTCTTTCTCAGCAATGTGGTAGTTCAGCTCTCCGTCGTGCAGCGTTCGACCGGTGAACCGAACTGGTACTACTACGC
CGTCGTGTTCCTGGCCCAGCACTGCACCAACCGCCCAGGCATTCGCGTGCGGGATGATCACGAAAGGCCGGTTCCTTTCCGGATGCCGAAGCAGTGGGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTATCTTCGTCTTGAGCAGCTCGAACGCCTGGATCGCTGGTTCCAACCGGTCGTTCGACTTG
ATTCGGTCGTCTGTCAGCTCGTAGAGCACACTGGCGACGACGGAGAAGTCTTCAATGAACTTGTTGTAGTAGTTCAGACTTCCCAAGAACGACTGGACTC
CTTTCAGACTGGTCAGGAACGGCAGCTCGCGCAAGCTTTTGACGATCTTT