Description :
From Genome Similarity Track
Location :
Scaffold_121:145695- 148346
Transcript NameFunction/comments
Hyaar_Emoy2810249hypothetical protein

Sequence
2651 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTACGCTGAG
ATGACTGCTCATCTCTCTCATCTCTTGAAAAAGAACGAGAAATGGTCATGGAACGCTGATTGCCAGCGTTACTTTGAAGGGTACAAGCAGAGCTTGATGC
AATCGCCCATCTTGGTGAATGTAGACCAAGACAGACCATTCCATGTGGTCTGTGACGCCAGCGATTTCGCAATCGACTGCGTGTTAATGCAGTACGATGC
AGACGGCGCAGAGCGTGTCGTCTGTTATCAATCGCGTCAACTTCAAGAATCGAAGCGTAATTATCCAGTGCATGACAAGGAACCCCTTACCATGAAGTAT
GCACTAGCAAAGTTTCGCGTCTATCTCCTTGGAGATGGGCCGTTTGTAGTCTATACGGACCATGCGTCATTACGCACGGCCGTAAACAGCCCACACCTCT
CGCAAAGGATGGCGAGGTGGATGTCCTTCTTTGCGGAGTACAACTTTTCCGTAAAGTATAAACCCGGACTACTCAATGTCGTCGCGGACGCGCTGTCGTG
CCGACCCCATTCCGAGTCGGCTGCGCAGTCCAACAGTGAGGTTGATACCACTGTTGCAATACTAGTCACTAGTGTCCCGTCGTCAACATTGCTTGACGAC
GTCAAAATGGCCTACGCAGAAGATAAGACTCTTATGCGACTAATGGATCATCTGGTGACTCCATCTTGTAAATCTCTCAAAGATTTACCAGCCTTGTATC
AATCTTTTGCGGATCGATACACAACACGCTACGGGTTGCTGTATTATACAGCCGTTACCGGCGACACTCCTCGTGTCGTCGTCCCCACTCATAATGATTT
GCTCTTACGCATCATGTATGAGTGCCGCGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAGGACTTATCTCACGGTAAGTCGCGACTTTTACTGTCCC
CGCCAGTATCAGTTTGTGCGCAAGAACATTCGTGCTTGTGAAGTGTGCCAACGGGTAAAGCCCAGTCCTTCATCCTGTGCGCCACTACAGCCTCTTCCAA
TCCCGGCAGAGTGATGGCATTCTGATTGAATGAACTTCGTCTTCGGTTTCCCCAAAGACTCTCGCAAGAATAATGGTATTCTTGTGTTCGTAGACCTTTT
CAGCAAGATGGTACATCTTGCTGCAGTTAATGAGTCAATCTCAGAACATGGTTGTGCCCGTGTCTTCATTGACACGGTTTCCGACTCCACGGTCTACCCC
GTGAACTAGTCTCTGATAGAAATCCTCGGTTCACGGCGACGTTTTGGCAATACGTGTTCCGATCCCTTGGAACACGTCTGACTATGTCTACTTCTGACCA
TCCCGAGACTGATGGTCAGACAGAATGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGAATACGTCCAATCTTTCAGATATTGGAGCGAATTTTTGCCG
ATGGTGGAGTTTGCTATCAACAACTCCGTGCATGCATCGACAACGCATACACCATTCTTCGTGAATGGCTTACGCCATTTACGCCTACCCCCCTATTTAG
AATGTGGCACTAATTTAAGGGGGGAGGGATTCGCTCGAGCAACAACCGTCCTGGCTCTTGCTCATCACGTGTCGATATAATCGACGACGCGAACGTTGCC
TATGTCGATCAAGTCGACATCGAAGGAGATAACCTTATCAATAGTGATGACACTATTGCTGACCCAGGTGAGGATGACGATGCTAGTATATTCAGCATCG
CCAATGACTACACCAGCGAGGATGAAAACACCTTCGCTGAAGAAGAGGATGACCTCCTAGCGGTGCGCATAAGGCGCACTGCAACAAACCAAAGTGATTC
AGCAGAAGATTTCCTGCTATCACGAGAAGAAGTGGTCCGTTTCGTGCAAGACTCCATCGCTAAAGCGGTGGACCGGCAGAAACGGAACGCTGACAAACAT
GGAAAGGCAAACGTTCTTCTACTTAATGTTGGAGACTTAGTTCTACTGCCTACGGTAAATCTATCTAAGCACGTAGTAACTAATGTGGGTAGTACTAAAC
TACTATTCAAGTACATCGGCCCGTTCCGTGTACTACGTCGAAAAGGTAATGCGTACACAATCGAGTTGCCTCGCAGGATGCGTACGCATCCTACGTTTTA
TGTCGGTCGTCTCCGCCCGTACCATCACCACGAGATCTCTTCCTCGGGCAA