Description :
From Genome Similarity Track
Location :
Scaffold_29:1456719- 1457748
Sequence
1029 bases(100 bases per row)
GATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCC
GGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGA
GGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTCTCGAAGATCCTTCTGGGATCGGGG
CGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGCTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAA
ACGCACTCGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGGCGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCT
CGGCACGGCTATGGACAAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAGCAGTTGCGTCACCAGGCGCTTAAACGTCGCCGGGGC
GTTAGACAAGCCCTGTGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGAGATGTCACTCGCCCGCATTAGGATCTGG
CAGTATGCGTCTACCAAATCCAGCGCACTGTACAGTACGCTTCCGGCCATGTTGTTTAACAACACATCCTTTCGTGGTATTGGTGTTTGGGCCGGCACCG
CTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTTCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCTTG
CACCATGCCTGCCTTCGCTTTCGCGACGAAGAAGGCATCAATGACCTCGCATCGTTCGCGCGGGAAAGGCCGTTGACCCGTGACACAGTACTTTGTGCCA
GGCACGAGATTGATCTCATGCCGTACGCC