Description :
From Genome Similarity Track
Location :
Scaffold_53:145629- 148641
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16055peptidase
Phypa_INRA-310PPTG_16056DEAD/DEAH box RNA helicase
Phypa_INRA-310PPTG_16057hypothetical protein

Sequence
3012 bases(100 bases per row)
GCAGCAAGAGATTCCAGCTGCATACGTTCTCGGCAAAGAAAGCGAGTTTGCACACGGATCCGCTTGGTGGGCCTTTGCCTTCGTTAACAACTGGAGCATG
CTACGCTTTGACGCTATTAGTAGGGACATTCGAGCTCGCATAGCTGAGTTGCAAAAGACTTGCTATACTGAGCGGAAAGCGATGGAGCACCACGTAACCC
ACACAAAGTCGTTGACAGCATCGGACGTACGCACGTATCTGCAGGAGCAATCGAATCGATTGGCTTCGCGAGTTATCGACGAATGGTGGACTTTTGCCTG
GAAACTTGTGGGCAAGTACGCGGATGGCTACATCACGACGGGTGAAGCTCCCGAGGATATGAAGATGCCCGGTTATCCGGAATGGTGGCTCAAACTCAGC
GAGTTCTCCAAGTGGCCAGGGGATACACTGGTGCCGCCACACATCCCAAAACTGGAAAAGCAGCTTGAGCTGTTTGAAAGCCGGCAAAATGCGAGTGCCA
ATCTTGGAGTGCAGCCATCTGCCGGTGACGACAGCGCTTCGCCTTCAAGTACTATTTCGATTGCCCAACTTGGCATCGGTGCTGTCGTTGGGGCCGTTGT
GGGTGCTTCCGCTACGTGGTTTGCTGTTCAGCGTCAACAGCGATCCAGGTACCTGCCCATTCCTTAGGACACAACGTGTTTGTGAAGAGCTTTGCGTGTT
TTATCAATGATCCTGGCAGAGCACTAATGCTTTGGTTAGTGCAGACAAGACTATGAACTACACCGATTTCGTAGCCATCAGATAACGTGCTTACCACCGC
AAAGCAAAATCAGACGTGCTTATCTATCTTGATGTGGCCTCCTAGTATCTTTTGTGCGGCTCCTTGTAAGTCCGCTTGGTCGCCGGGCTTGCAGAACGTT
TGTGCCTGCGAGAGTGTCCTTCACGTTTCGTACTCGGTGAAGCACTTCTACTGCTCCTGTCGCTCTTGAAAGACTGTTCGCTACGAGAAGACTTGGCTTC
GTTGTCGTTGAAGGTTCTCCACAAACTACCTCCTTGTTTCTCATTGCTGCGATCACCCTTCTTCTGTCGAGCGTGAATCGATTGATAGCTATTCCGATTC
TCGCTTGTGAATCTTTCCAGCTCTCCCAGATTTTTCGACTTGGATCGTCCAGCTCTGACTGGTTTGGAAGCAGCAATAAGGCCTGGAGTGCCCATTAACC
CCATCGCCCGCAACGTTTTCTTCTGCAACAACGGCACTTTTTCCAGTCCAATAAGCTGACTATAGAGAGCTCCCGTCTCGACAAGCTTGGTTTTCGACAT
TCCCAGCTTCTTAAGGTTCGAGTTGTAGAAGCCCAAGAAGGCAGCATAAGCCTTCTCTGCTGATTGGTCCAATTCACTGCGTAGACGTGCGTTTGTGAGG
GCACGAGTGGTTCGGTAGCTCTGCTGATCGAGCTGAGGATGCTGCTTTAGCTCAGTGAGCGGGAGGTCCGCTAGATAACGAAGCATTGACTTTTCAAAGT
CGGCCAGCACTAGAATGCCACGTCCCTCCATACCCGCACGGGCCGTTCGTCCTAGACGATGAATGTACTGATCGCGATCCGTCAGACCCACTTGTAGGAC
AAGCGACACGTCTGGGTAGTCGACGCCACGCGCCGACACATCTGACGAGAACATGATCATCTTCTTACCCTTGCGGAAAGCGTCGGCCGCCTTGGTTCGA
GCAGATTGGCTCTTGCGTGAATGCATCTCCAACACGTTCTGGAAACCCGCACCCTGGAAGAGTTGCGCCATGAACTGTGCCGACCGTGCGGTCGGTAGGA
AAACAATGACCTTGTACGCCGGCAGCTTCATGTGCTCTTCCAGTACGCCTTCCACTACGGGGATGACGTCTTGCAGGTCGCACACAACATACTCCTGCAC
AGCCTGCGTGTTGGTTTGTTGATCACCACCTTCGATGGTATCTACAAAGGCACAGTCATCCCGTAGTGCCATGTCCTTGAGCTCCTCAGTTGCGGCCGGT
AGCGTCGCACTGAAGAGCAGTGTCTGACGCTCTTTCGGCAAGTGACTGATGATCCGCATGATGTCGGGGCGAAATCCCATGTCCAACAGGCGGTCGGCCT
CGTCCAGCACCAATACCTGAAGGCTGTCTAGCTTCTGTCTGATGCGTCCGCTGTTGTCCTCCAAATGTGCCTGCAGTCTTCCTGGAGTGGACACCAGCAC
GTCAATGCCTCTGGATTGCGTCAGCTCCTTCACATCCTTGTTGACTGAACTACCGCCTACAAAGCAGGACGTGCGCAATCCATGGGCGTCCGTGAGCTTC
ACCGCTTCGACTGCGATCTGCTGCGCCAACTCTCGCGTTGGAGAGATCACAAGAGCCGAGATTTTGCCCTGCTTGGGCTGCGGGTGCGTGAGCATGCGCT
CCAGTGTGGGTAGCAAGAAAGCAATGGTTTTGCCATTGCCCGTCTTGCCCTTGGCCAGTACGTCACGTCCGGCCAGCACCAACGGCAATGTATCATTCTG
CACATGCGTTAAGAACTCGTAGCCCATCTCTCGCGTGAGTACATCTTTGGACCGCTGGCTGATTGGCAACGATACGAACGAAACATCCGACAAATGACTA
CCTGTAGAGGTCCATGGAATGCAACTCGAGCGGAACCCGCGCGCAGTAGTCGACAAATGCGACGAGAGGCGGCGAGTGCACGTCCACATTGCTCAATTGG
TTGGCAGTTGCAAAACCCAAAATAATCTTGTTTAGGTACTTTGAGCATGGTATATTGGGAAAGGTGGTACTGCTATCGCGACAGAGATTGGCTAATAAAA
AACCGAGTGGGCGTAGACGTGACGACAACGGATCTTATTTCGGGGAGCCCATTGTGTGATTGTTCGAAGACTAGAACGATGACGCTCGTACGACTGCTGC
GGGTGGTAATAGCATCTCTCGCTATGCTGGTGGCGGTGCCAGCGCCCTCGAACGCTATGATCGTTCAGCTGGATGGACGCGTGGAGGAATGTTTCCACGA
GTATGTGCGTAC