Description :
From Genome Similarity Track
Location :
Scaffold_583:14562- 16799
Transcript NameFunction/comments
Phypl_g9592hypothetical protein

Sequence
2237 bases(100 bases per row)
ATTGCTGTTCCGTAAGGAGGTTACGCTTTGTGTTCAATGGTGCACTCAAATTACATGTTCGCGTACTCTGTGAGGAGGTTAACTTTGCTGTTCCATTTGG
AGGTTAAGCTTAGTGTTCAATCGGTGCTACAAAtttatatatatatatatcCTTCAGACTCCTAAGCTTGTAATACACTCGGTGTCCGTCCCTGATGATT
ACCGTTCTGTGTTGTTGAATGTGTTGTCCTCTACAGCCTTCCCTTCAAGGAAGGTCTTGCgggcaagaaggcggcgctccttctcgaaggcggcgacgac
ctTCTGGTTCAAGTGGGCCTTCGGCTCTCAAGTCGGCTTCCAGTCGACGAGGTAGTAATTCACCCGCTTTTCACGCTCCCagttcagcagcttgcgggCG
TAGTGCGCTGGTTCACCCTTGAGGGCTTCGCCGAGACTCTGCTCCTCTTTGTCTGAGCCTTCGTCGTCCGTAGGTGCAGGAAGAGCGAGTCATTCTCGCA
CGTATTCAAGGCCGATTCTGCGTGTCTTCCGTTCGGCGAGCGAGGCGATGGTGAATTGGATCGCTTCGGGAAGAAGGCTTGCGAAGGCGCTCGTCGTGTT
TATGGTATGGCGCAGGTGACGGATGGCCTCATTATTTACTCGAATCTTGTACGACTTGCTCCCAGCGATACACAAGATTTTGAACTCTTTcgcggagctg
acggcgTTCTTGGTAAGCTTGGTAGGATGACAGAGTAGTGTGTGGTGCAGTACCGAACGCAAAGTGGCAATCTCAAGACAATCGTCAAGACTAGTACACG
CGGCAACGAATGACTCAGACAAAACAAAGGTAACGTTTTGCGAAATTACGAGGTGGGCTCTATATCAAGGATGTTGGTGGTATGCACAGGTGCACAGTCG
ACAATGCGccctgcagcttgaagttgcTTGTGGCATCGGATGAGGTCGTTGAGATTGCCAGCcttgtgcagcttgcgcatgGACTTGAGGACGTTTTGAG
ATCCGCGGGCTGTGATCTTGTGCTCGACAAGAAACAACAGGAGTTTCTTCTCAGCGGTTGCACCGAGTCCCAGCACATCGTCTCGATACTGCGGTGACTT
CTCGACAAGCACGAAGCCATTGGAAAGAaacagcttcaagaaggTCGCgaccagcttggcgttggaCCTCGTGTGCTTGATGGCGCCATCGGTTGAGCTC
CAAATGCGGGGCCCTTGGGCGTACCATGAGAACCAGACATCCTTCaggtttgttgctgctgcggcacgacgtcgctttgctggtggttCATTGATTGTAT
CCTCACCTGCTGCGTTTGTGTCTGGTGTCTATTACGTCTTGTTGTAAACTGTAGCTTCCATCGTAGACAGCCGAGCGTCGAGTTTGTGATTGATCTGAAT
TAACTGTTTAATCAAAGCATCTTGGTGAAGAAACGTTGGGTACTTGGTGATATCGCTCGTTGATGGTGTGGTCTTTTTTCGATGGCATACgcttcaagac
gctcgacagcaagtcCGCCCGCTGCAGCGATGGATAATGGCGCAGCAGGTATGTGACGAGAGTATCAAGCACCCTTCCATTCACGTTGTACTGCGCTGTC
TTGAGTCTGTAGGAGCGTGTTGAATAGCGCCGAAGCAACGGTTCGAATCTTCGTCTGGGTGTCGGAGCCAAACAAATCCAGCGACAAGAGCGGAACAACT
GATCAGGATCCAGGCCACTCAAGACGCGACCGACCTTGTGATCTTTGGCCGATGTGTTGAAGACATACGCGAAGGCCTTGTTCGTCGCTGTCATGTCCCA
GGCTCCCCAGTCGAATATCCACTGCACACACATGCCGGTTCCAATGGCGTTGTGTGCTCCACCGCGTCGAAAGGAATGCGATGTGAGGCGCTCGGTCACA
CCAGCGTTTTTAGCGACTCTCTCCAGGACGCGGTTGACGTAGCTGTGGATGCCCGGGGCAGAGTCAGTTGTCTCGCCTTCATCCGAGCGAGTTGCTTGTA
GTGGTACAGCATATCGTGGGTGGTCGATCAAGTCGTTGAGAGGCGTAGCCGGAGTCAAAGTGGCTTGGGAACTTGCCAGTGGTTCAGGAAGCTGACtcag
cagcgctgccatcggAGAAGTTTGGGTCGCCAGTGCAAGCTCAATCGCGAGCAGTGGGCTCGTGGTGAAATTGTCATTAGGAAACAGCGAGAGGCCACGT
TATTCGACAGTCTTGATataacggggttacacgaaga