Description :
From Genome Similarity Track
Location :
Scaffold_1038:1456- 3602
Sequence
2146 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAGCGTTGGCCACAAGGTATCCGGTGAATAAGTCAACCTATATCAGAAGTTTCATATTTCCCTTGTACGACTTAGGCAGAGACGGGACACTGTC
CATCGCTATAACTTGGAAAGGATCAGTCGCTTCAATGTTCCCAGGGCTCTTCCCTTGTAGGGTAGGTCCCCCTTTTCCAGTCTCACAATCCATGCAAGAA
CCAACATATCTATGCACACTCCAAAACAGACCTTTCTAGTTACAGTAACATCGTATGCGTTGGTATTGTGCTGGAGTGGCATTCGCTGATGTTATGAGGC
GATCCCAACTCTCCACTAGTGCCCAGAAGACCGACTATCGGAGGGGGTACTCCATATCCGTGCCTTGTATTTTCTTCCTCACCTCGTGTACCCGTCGGTA
GGGTGGGATGCACTCTTCTCGGTGGACTCATGTCGAGGGAAAACTTGACCGTGTTGGGGGACGGGGTTTGTGATCGTGCGGAAATCCTCGCACGATCACG
GGTTTACTTGATGTAAGCCACCCAGATCTCGAGCGAGATCGCCCTATCCACTATTTGGATGCTTGATACGCAAGCCTTCTGACCACTTGAGCCGTCTCGC
GATCTTGCGCCTTGTCCTTTACGTTCTTCCTGTTTTCGATCGAAGTTGGGAGGAGGTGAGAATTCTTGATCCCCAGCCAAAAGTTATCTGGGGATAGCGC
TTGGTTTCATTATGCGCGACTTTCTTGACGTCGGGAGGCCAATATTCCAGCTCGGAAGAGAAGTCGACACGTGTACTTAGAAGCAAATTGAATTCTGTTT
AATATAAACCAACCAAAATTTAAAACTACCATTGTTCCTGTCTGTATGCCAGGGCATGCTACCACACGTCCTCTGCATTCCCTTGATCGTTCCTTCGCCT
ATGTGGTCCATTCTTGATCGATCCTAGATCGCCTGATCGATCGGTG