Description :
From Genome Similarity Track
Location :
Scaffold_36:145596- 148893
Sequence
3297 bases(100 bases per row)
CTTCGGGTGCTTCCGTGATCTGGCTGCTGCCGGTCGCCCGACCTATGGGTCGTCTTAGGATGACTGGCGGCATGTCATACTGCGGATGAGCGACCATCGG
CTCCTCGATCGGGTTATTTTCTCGACGGTCACATCTGTGGTAGCCTGTAGTACCAGATTCTGCCACTCGGCGTACCGACGAGATCCTACGGTGATAAATC
CCTGACGTCTTGGTACACGATCTCCTGACAGCCACATTCTTACCGAGGTATTAGCGGGTAGACATCTCGTCCGGTCACTGATTCGTGATCTTCAGGTAGC
AACTACATGCAGGCCCTTCAACCACGGTGGGAATCCTCTCCCCGAGGGATCCACAGTGCTTGGGTCGCAATGGCATCTCGATGCTCTGTCCCGCGTCTAT
TATCTTGAGTCCGTCCAAACCGACCGGGCGAACGTATTTGCCATACAGCGGGCGTCGCCCTGGCAACTGGATGCGGACCTCGTCGGGTAAGCTTAGCGTC
CCGTCGGCCAAATCCAAGCAAATCCCCGCTGATAGCATGAAGTCCATGCCGAGGATCGCGTCTTGGCCTGGCATCTCGTCAACCCACACGTCGAAGAAGT
ACACCATGGCTCCAGCAAAGGCAAACTTTGATCTTGGAACGTCCCTTCGTAAGGCACGCACTTTCTTCAATTCCAACACATTCTTGAGGTTGACTTTCAT
CCACATAGCACCCAACCTTACGAGCAAAGGCGGTGTCCAGAATGGACACCTCAGCGCCGGAATCTAAGAGTAAGTTCGCTTTTTCGTTGTTAATTTTCCC
TCCCGTCTTGGCTTGCTTGAACCACTTACTGGGTGCGTGGTATTTTCAATATCCACGCATCTCTCCTGGCAGTAGATCAAGCGTCATAACAGTATCAACT
CTCGCGAACTCATCAAGCTTGCGAAGACTTGCAACAACACCGGTACTTGTTCCATGAAGATCACATGTATTGTCGCTCGGATTCTCCCGTTCACTAACTT
CGGATCTCTTCTTGACGTATGTATAGATGCAGAGCTTGGAACGCTCGGTCGTCTTGGCTTCCAGCCAGGCGAGCGCTCTAGTTTAACATCTTCTCGGCGC
TTTCCGGTAACACACCACTATGCTTGGCCGGGTTGTACCACTGACGGATCAAATTGTAAAACTCCTACATCCGGCACTTACAAACATCGTGGATCTCGCC
GCATTTGCGGAACACGAAGAGGCAACGATCAGACGGGTGGTCACAGCGCTGACACGTCAGCCGCTTCCAGCAAAGTAGATCGTCTCGACGATGCGAGCCG
CAGTGTGTGCATCGTTGGAATGTGCCACGTCCATGCGGTTGGCGTTCTCCTGGGTCGGGGTCTCGTGGGGCCAGCGTCTCGCTAGGCGTGGCTCGATCTA
CTCGATCTGTTTCCTGGCGTGATGACCTCTGGGTCGGATCCTCTCCTTCGGCGGCGGCGATGTAGATCCGGCGCAGATCTCCATCGGATTCTGATCCACT
GAGATTCGAATCACTGCCGCAGTCCGCAGCCTTCACGGCTTGCACGTTGCGTGCTGGGGTTGACTTTACGGCGTTAGAAGTAATTATCTTCTGTCGGTAC
TTGCTCGATCCAAAGTGGGCCTTTCCCAGACGGTTCTGTGCAGGTTGCCGCGCTCTCAAGACATCTTCAAGCGAATCTGCATCTGCGATCCGTAGCAGCG
CAAGCTGATCAGCCAGATCGCGGTCATCCAATGTTTTGATGAAGTGTTCCACGTGCTCATTGCGGACATCCAGCGGGCCATGTTTAATACGCAGCTTCTC
CCTCATTTCTGCAACGCTCAGACGGTGGAGGTACGCTAACGGTGTTTCGTCGGCACGTTTCCTGGCATGGTAGTACGGCATCGCGACGGATGCTCCGAGC
CCACAGAACTGCACTTGAAACACGCGTAGGAGTTCCTTCCAATCGCTTCGAGTAGTCCGGCTGAGTTGCTGGTACCAGCTGCGCGCCGATCCAGTGAGCA
GGTCGCCACGCACCAAGCACTTCTCATCGTCCGGGGCCTGATCGTGGAGGAAGGCTGACTTTACCTTGCCGACCCACTCGCGCGCGCAGTCTTCGTCGTT
ATCCTTCCTGGAGAAATCCTTGAGTTCCGACATCGGGAGACACGAATGCGTGGAGTTATCCCAGACATTCCAATTGTCGTAGCGGCCTGTACCCACTATC
GGTTGACGTGTGTCTGTGAAGTCCAGCTCGTCTGGATCGTACTCACCGTGTTCCAAGCCAATCGATTCCATATCAACGTCGTGTTGTCCGGTCGCTGCCA
CTGGTACCGCGGTCGGGTCCCTTGTGCAGGCGCTGCTCTTTCAGGAAGCGTTCCATCGCTGAGTTGAAAAGCATCCGCAGTCTGCTTCGATTTCCAGTGT
CGGTCGCCCAGCGTCGGCGAGTCCGCCTTAACCTCCCGCCTTTACCGCATGATCCCGGTCGAGACTGCAGCAGTGCCGCGCTCGACGGTCCCAGCTGCAT
CCGTTCAACATCATCGATACTCTCCGAATATGCACTTGAAGCCGCGGAGGCGTAGCGAGATTGTTGGGACGTACGGTCCGTGACCCAGACTTAGGGGGCC
GTGGCAGGCCGGCAGCGGGCTTGGACTCTGTCTTGATCTGAGTCTGTGACTCGCCGACCAGCACTCTCAGGTTCTCGAAGAGCTCCGACTGTGGGTTCTG
GATCGTTTCGAGATCCAGATAAAACAAATCCTTCGCTGCAAAGGGGCCTGGCGTGACGCCGGCTTCCTTCAGGAGATACAGTACGGCTTTCACAGCCTCC
AGCTTATTCGTCGTCTCAGGTGGCGGTGTCACCGGTCCCTTTAGCGATCCAGATATCTGCGGCTGTATGATCATCATCATTGTTTTCTTGGCCATAAACC
TTTGAAGCTCATGCCGGTTGTATTCTTCTTCCAGCTGATCGTCAGACCAAGTCGCTGCGATCTCACCGCGGCTATCGGAGTCCGAGTCAACTGGGGTCTT
GAGCTTCATCCGCGATGCCTTCGGATTCGTCTTCTTCGAAGTCTTCTGCGTTGGTGGAGCAGTGGTTGATGAGGTTCCTTCGGTTTTCACCTTGGGTTCC
TCATCGGGCAGATCACGATTCGCATCGCGACCCGCGGTGCCTCCAGAGGGGGCATGGGGGGGGAGGTCTCTCTTCACGAAGATATTCCTCTTCGTTTCTA
TCGGCAGAGCTCCTTCCAGGGCTCTGTCGATCTGCTGATCCTGCTTCATTCAGCAGCGTTGTTGGCCGTCCAGATTCCGATGACGCTCCCATCCTTG