Description :
From Genome Similarity Track
Location :
Scaffold_735:14558- 16452
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_735-fgenesh-gene-0.7Conserved gene of unknown function
Pytir_DAOMBR486snap_masked-pir_contig_735-abinit-gene-0.18N-acetylgalactosamine kinase

Sequence
1894 bases(100 bases per row)
TGTGCTGTCTCAACTCTCTCGGCGGTTGTCTGGCGCCAAAGGTCAACGGCAGAGTATCCATGTCACACATATTTGCTCGGCTTCTCTGATCACCAAGTCG
AACGGGTACACTACTCGGTCGATTCTGTCGGTCCTCCTCAGAGTAACCTGCTCTGGTAGAAGCAGCAAAGCTCCCATGATTACCCATTAGCGATGGGTTA
GGGAAAACCGCAAGCTGTGTCTTCTCTTGGAGCTGTTTAGCGGCTGCGAGGATCGTGGCTTCGGCTCTCGTGCGCTGCTGCTGGATCGCGGTCTGCATCT
CGCGCTGGATCTCCGCCACTTTCGCGACGTACTGCTGCTCAAAGACCTCGAGACGCAGCGCAAAGTTCTAACAAAGCTCAGTCGAAAAGCATTAGAATAT
GAATATCTTGATGAAGTCTACGCCAGTAAACCAAAGAGCTCACACTCATGGTACCTCTTCGATCTGTTTGATCTGGCTCTGCAAGCTCCGCTCTTCCTGC
TTCTTCAGAAACTGGAGCTCCTCGATCGCCTGGTCCAGCATCTCGTGCATCTGGTTGGCTGTCGATTCGCGCTGAAGTGTCATGCGCTTCACGTGTTCGC
ACAACGAGTGAACATGATTGACGATCGACAGCTGCGACTGCTGTGCATCTTCCTCATCCGTCGAACTTTTGATCTCTTCATCTTTTTCGTGCTCTGAATA
CATTTGCCTAGAAACCATTGAGACTGCGCTACTGCGTCTGCTTCGGAAGCGATCTGGTGATTCAAAAGCCTGACGAGTAACTGGAGAAAGCACTTTGTTC
TTGCGTCGAGATGGTGATGATGACCCAGCAGAAGTCGAGCGAGGCGCTCGTTTCTCGCTTTTGCTCGGCTGGCTCAGGAAAATGCGTCGCAGCCGCTCGA
GTTTGTCGGCAGGTTGCTTTACGGTGCACTCGTCGCTGCTGCTGGTGCTGCCACTGTTACTGCTGGAACTACTGGAGCTACTGCTGCTGCTACTGGAGCC
GCTGCTCGAGCACCTCATCGCCCTGCGAGAGCTGTATCTGTGCATGATGTTTGGGTCACAATTGCACAGACATGGTCACGTCCTTTCGAGCTCGCACAAT
TTGGGCCAAGTTGTACAGTTGGCCACTTTAACAAAGGCCCGCTTTGACGATCTGATTCTTGACCTAACACAACTGCAAAAATCAAGATGGCTAAGCGGAC
CACGAACGCAGGCTTTGAGCCGATCGCACTACTGCGCGCTGAGCTCAAAGCAAGCGCAAGCGGGCAAAGCGGTGGTACGGCCCATAGACAGAGAGCGCAG
CAGCTCGCGCGTGCATTTCAAGAGCGCTTCCAATGTGCACCAGCGGCTGTTGTGCGCGCGCCAGGANNNNNNNNNNNNNNNNNAACCTCATCGGCGAGCA
CATCGACTACGAAGGATACGCCGTGTTGCCCATGGCGATCCGACAGGATATCGCCATTGCGTTCCGTGTACGACCGCTCGTCATTGATACAGGTGGTCAT
AGCGGCAATGCTGGCGACGGAGCTGGAGTGGCACCAGCATCCACGCTGACTCTTGTGAACACGAATGCTGCCGAGTACGAAACCATAGAGGAGATCCCTT
TCCCAGCAATCGGCTCGGAGACGCCCCTGCCAGCGCATGATCCTGCTAACGACAGATCTGCATGGGCAAACTACGTGCTGTGTGGAGTGATGGGCGTCCT
CAGGCATTACACAGGTACCAATATCCCACACGTCCACATTGACATGCTGGTCGATGGCGTCATCCCAGCAGGCTGTGGACTCTCCAGCTCCAGCGCGCTG
GTCGTTGCCTCGACACTCTCTGTCGCGTATTCACTCGACCCTCTCAACGTCCCTGCGCGAGTAGAGTTGGCCGAGATTTGCCGCAGAGCCGAGC