Description :
From Genome Similarity Track
Location :
Scaffold_4:1455649- 1456862
Transcript NameFunction/comments
Physo_561369myosin-like protein

Sequence
1213 bases(100 bases per row)
CGCCGCACCCGTACTCGATCGCCGAGATGGCCTACCAGCAGATGGTCTACAACTCGGGCACGGACCAGCCCACGAACCAGTCGGTCGTCATCAGTGGCGA
GAGTGGCGCCGGCAAGACCGAGTCGTCCAAGATCGTGCTGCGCCACCTGACGACGCGCGGCCTGTACGGCAAGAAGGCGCGCGGAGATGACATCGAGAAC
ATGTCCAAGACCCGCCAGCAGCACGGCACGTCGCTCGACCACCGTCTGATCGAGCAGAACCCGATCCTTGAGGCCTTCGGTAACGCCAAGACGCTGCGCA
ACTACAACTCGTCGCGTTTCGGCAAGTTCATGAAACTACAGTTCACGGCCGACGGCGAGTTCAAGCTGGCCGGAGCGCTCGTGGAAACGTACCTGCTCGA
GAAGTCTCGCCTCGTCTACCAGGTGGACGGCGAGCGCAACTTTCACATTTTCTACCAGCTGCTGGCCGGTGCCTCGCCCCAGGCGCGTAAGGAGTTCGAG
CTCACGCAGGCCGAGGACTTCTGCTACCTGAACCAGAGTGGCTGCTACATTGCCGAGGAGACGGATGACCGCGCGTGCTTCGAGGCCGTGGTGCGCGGTC
TCAGCTGCGTCGGCATCGATGAGCAGGTCCAGCACGTGATCTTCTCGGTGGTCGCGGGTCTGCTGCACCTTGGTAACATTGAGTTTGACGAAGAAGATAC
GCCTGAGGGTGAGGCCGCCGTCATCGAGAAGGACTCGGCCAAGCGCGCTATCGTCGCGGCATCTAGGTTGCTCGGTGTGAACGAGCAGGACCTGCGGAAG
GTGATTATGACGCGCGACATTGTGACGCGTGAGGAGACGTACACCGTTCGCCGCAACGAGCAGGCCGCCGTGTACGCGCGTGATGCCATTGCCAAGGCGC
TGTACAGCCGCATGTTCGACTGGGTTATCAAGCAGGTGAACTCGTCCTTGGGCCACGACCCCAACCCGCTGCCGTACATTGGAGTGCTCGATATCTTTGG
TTTCGAGTCGTTCCAGCGCAATGACTTCGAGCAGCTGCTTATCAACTACACGAACGAAGTGCTGCAGGCTACGTTCAACAACCAGGTGTTCATTGCTGAA
ATGGAGCTGTACAAGCGCGAAGGTATCACGGTTGGCCGGATTAAGTGGCCCGATAACCGCGAGTGTGTCGACCTTATTGCGTCCAAGCCCAACGGCATTC
TGTCTCTGCTCGA