Description :
From Genome Similarity Track
Location :
Scaffold_95:14555- 17157
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_95-fgenesh-gene-0.8Bifunctional aspartokinase/homoserine dehydrogenase

Sequence
2602 bases(100 bases per row)
CCGAcTCCCGTGCGCCGCAGTTCCGGGCGAGGCTGAGGATGGAGCCGAAGAGCGTGCCGGCCGTGATGGCGCTGtCGGCCGTGGGGCCTGTGACGACCAC
cGGGTGACGCGCGTGACGCGTCGTGTGGAACGCGAAGCCGCCCTGCAGCGGCTGGAGCGAGGCCAGCGCGTGGGAGCTTGGCAGCGCCTCTACCGCCACG
CGAATAGCGCCCGTCAGAGCGTCCACGTGGGCCAGCACACGAGGAGACGACTGCGCCGCACTGGCGGCAGCAAGCTGAGCCTGGAGAGGAGctGACTTGt
cGACGAGGAACGCCAGCAGCTTCTCAAAGTCCCAGGCGCGGACGTCGCCGTCACTCTCACTCACACGCCAGCATGAGTCGATAGCCACGtCCTTGAGCTC
GGCAGGGAACCCCAGTTCACGAGCAACCAGCACGGCCTTCTTGGCGATGCGCGTACCGCTCAAGTCGTCAAGGATGTCCTGCACACTCATGGTCTTGCCG
TACTCTTCAACGTGAAGCTTGAGTACGTCCTCAAGGGGCTCAGACAGCGCCTTCTGAAGGATCGAGTTtaGCAGTCGGCTGCCCGAGAACTCAATGTGCT
GAATCTGGTCTCCCGTTTGGACAAAGTTCTGGATTGTGCTGAAGATGGGGACACCGATGGCGATACACGCCTCCGTGTCGAATGTGAGCTCACGTTCCCA
CAGCTTGTTGCGCAGCTGGCGGTGGAGAGCAGCAGAAGAAGTCGCCACGTTGACGTTGGACGTGATCAAGTGCACGTTACGGTTCAACCACGCAGGGTAC
AGGTCGCGGACATGGCTTGAACAGTTCGACACGTCAACGATGAGCCAGTGCGGCAGGTGGTCGGCGCAAACGTGGTGTAGGAAGCGGTCGTGGTCAAACT
CTTCGAGCTCGTTCGCACGATCAGCGAGGCTGTCCGAGTGGATGCCACCGTTGTGGTCGAGCAGCATCTTGGAGCTGGAATGTGTCGCAATAGCGCGGAT
ACGGATGTCAACGTTGAAGCGCGTCTTCAGATACTCGCATTGCTGGTTGTACTGCGAGAGCAGCTCGCGACCAACaCCGGTGAGGTCATTTTGGTCGAGC
TCGAGACCAACGATACCGATGGAAATGGTCTGGTCCGAAAGGAAGAATGCCGAGTGAACCGCACGCAAGGCAGCGGCCGAGTCTTCGTAGCGAACAACCG
CCGAGATGTTGCGTTCCGACGAACCTTGCGAGATGCCCATAACGTTGATCTTGGCACGGCCCAGAGCTCCGAAGAATCGGCTACACACGCCTGGCGTTTG
GCTCATGTTGTCGCCAACAGCGGCGATAATACTGATGGGAGCGATGAAGTCCGTCTTCTCGATGAGACCGTGGTGAATCTCCTTGAAGAACGTCTCATCC
ACGGCAGCCTTGACATCAACCGCTCGACTCATTGGAACAGCAAAACAAATCGAGTGCTCGGAGCTGGCCTGAGCGATGAGTACGACGTTGACCTTGATGC
GGTCAAGAGCACTGAAGAGACGAGACGACGTGCCGTGCACACCAACCATGCCACTGCCTTCAATGTTGAACAGAGCAAGGTTATCAACGGTCGAGAAGCC
GCTGACAATGTTCTTTGCAGTTGGGGCACCGTTCGACGCCGTTCGCTTGAGCTCCACACGCTTGCGACTGTGGATCTTCGTACCTGGGTGGTTCGGCTCG
AACGTGTTTCGGATGAAGATAGGAATGGCTTCGAGAATAGCAGGCGTCATCGTCTTCGGGTGGATGACCTTCGCACCAAAGTACGCCAATTCCATGGCCT
CCTCGTAGGATACTTCCGGTAAAATCTTGGATTCAGGTACTCTTCTCGGGTCGGAGCTCAATACACCACTAACGTCGGTCCAGATCGTGATGCTGCTCGC
ACCAAGCACTCGaCcACAGATGGAAGCGGTGAAGTCACTACCATCGCGCTTGAGCGTGGTCATGACGCCATCGGTCGTGCTGCAGATAAATCCCGTGATA
ACCAAGTGGGTGTGCTCAGGACCGTCACCGTTCTTGAGAATTtCCTCCATGTTCTTCGTCGTGCGCTCGTACTGCACGACCGGTCCGTGATCTTCGTCCT
GATCGACAATGAGGAAATCGCGcGCATCCACGAAGCGATACTTGTGGGTGTCGCCGTCCTTGGCCGCACGCAGTGTCAGCACCTCCGCCAAGATCTTGGC
GGACCAGATCTCACCGTGTCCTGAGATGAACTCAACGACGctaTCGTTGTACGAACGCATGATcgagATCGCGCGCAGCAACTCGGACAAACGCTTGAGA
TCGGCCTCAATGGCATCTTCAATTGGCTTGCCAACTTCGGtGGGTAGTAGTGAATTGATGACATGCCGATGCTTATTGCGGATCGcGTCGAGGATTTCCT
CGCAgTCCTGCGCCTTGCGCTCCTTCGCGAGTGTGAGCAGGCTGATGAGCAGATCCGTGACCTTGGGCTTGCCaCCGATGGCGGACACgaCGACGGCGAT
GCGTGGCGACTCGATGGCAGCCACAATGTCGGACACCTTAGCGAAGCACTCGGCGTTGCCCACGGACGTGCCGCCGAACTTGTGCACAACGAaCTTGTTG
CT