Description :
From Genome Similarity Track
Location :
Scaffold_3:145543- 147999
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.42Metalloprotease family M01
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.32Ankyrin repeat protein

Sequence
2456 bases(100 bases per row)
TCGGCTTGGTCTTAAAGTAGACGTCGCCGGCAAACTTCCGAATCACGGGgCTCGTACTTGCGACTAAGAGACGGTATGTTGGgATTTgAACTTTTGCTTC
CcTTGAATCGTGAGGAaTCGCTCAACGAaGTATGTCTtGCTCTcAACTGTGtttttGATGaTAACCTGAGACcATCGAAAGAGAACTtCCGaGTTtGTCG
ACTCCCACAAtCCAAGCGCATCaCCAagTTggATGACGACATCTTGCTGACTGAATGTCGTATCGATGCACAAGTCCAAAAAGTAAaGAAGCTGGGATAC
GGGCCATGACCTCGCCTCACCCGACAAGTACAGCACATTCGACTGAACTGGAACATCAGAGGACtCCcAGTAGTACAAAAGAGTTTCGCAAGTTTCCATC
ATGTCTTGAGCACcTGACAAATCAGGTGTAAAGTgTGGgAACCcGGGGgCATGGAGCcACGTTGAGAATTTGATGGGAGCCTTGAGCTCGCCATTGTCAT
CTGACAaGTGAGGgAaGTATTCCAGGAAGTACTTCATCATTGCCTCGGCAGGAATGGACTGAAATCGGAAgTGTTGGGTGTAGTCGCGTAGAAACTTATC
GAAAACATCATCCGACCGCACTAGGCTACGAAGGTAGCAAACAAAGTCGTATCCTTTCTCGTAGGCACAATGATTGTAGCAATCACCGGGGTCAATGCCG
GTCTCCAACGGCACACGAAGACGAGTTAGCGGATCATCTTCACCCAGCGATGTAaTTTCTTCCTTGAGCAGTGCTTCACCAATTTTTGCGCTAAGACACa
TGAGGGgCCTGCAAaTATCTCGTCAAGCACAATTTCGaGAGTCACATGGCTCGGCTCAAACGAACCTTCCATGGGCTTCTTCTGTAATCCTAcGTTCTGC
ATACATCGTAAAACCTTCATTGAGGAAGAaGTCACTCCAAGATGCATtCGTCACCAAGTTGCCGAACCAGGAATGAGAAATCTCGTGTGCCACAGCTATT
tATACCACAGGTCAGCGAACAgtAGCAAATGAAAAGTTGAAGAGTACtcACTCGAGCATAGAGATTGATCGCCCGCGACGATACAAGGTGAAaCAAACGT
CAGGCGTGGATTCTCCATTCCGCCGTAAGGAAACGACGGTGGCATAACCAGCAGGTCATACCGTTCCCACAGGTATGGACCGAAGAGCCTCTCTCCAATC
GTGAGGTACTGCTCCAGAATACCAGCGAACTCCTTCTTGCTCGCATCCAGCATGCAAGGTTCAGTCCAAACACTTGAACGTGGGCCAATCTCCGCGGATG
CTAGATCTCCGACTGCCATTGCGACGAGATAcACTGGAATCGActGCTTCATTTCAAAGCGAAAGCACCTTCTCCCACTTTCCGTAGTATCGCATCCCAA
GTGGCTTGCGCTCATCACACAGACCAATTCCGCTGGGACAGTAATCTCAGCCTCGTACGTGATGCGCACCGACGGTGAGTCTTGGCAAGGGAAGAAGCTG
CGGTTGAGCACTTCCTGGCCTTGGGTGTAAACAAACGGGTGTGTTTTCCCTGCTGTCTGCTCCTTGCTAAGCCAACAAACAGCTGGGCTTTCGGTGCTCG
TGCTATAGCGAATATGCAATTCAAAtGCGCGTGCTTCGCCAAGAGACGAAGGTAACTCAATCGCGAGTGTTTCACCGAAACTTGTGAATGGCTTGACTTC
CCATTGCGCCACCGGCTCagATTCACCGCATTGTTGCGTACCGACGCCATTTTCGCTTTCTCCTTGGCGGCTACTACGTGTAgCAACGCGTACGTCGAGA
ATCTCGAGGTGGAACACGTCAAGTTGCAGTATGTTTCCTCGCCACCCGTCGAGTTTTTTCATATGCAGCGTCGCAGCGCCTGCAATTCGGCGCTTCTCCA
TGTCTACGTCGAGCTGGAGACGCAcATGGTGCATCTGAACATCATGGAGCGCTGCGCACGTCGCTGGATCCTCTGCTGTCGCCGCCATTACCATCGCACG
CGCGTTCGTTTCCTTCGCTTGTTGCTTCTTTCTTTCGTGTGGATGAATGACATGCCTCCTTCCAGCGGAAAGGAAACTTGTCACTACAACTTGAATCCCT
cGTCCTAATGACGTTCGTGGAGCCAAACGTGGCACACACGCGAGGGAGTAGAGGCGTTTAGTGACCGATcTGACTGAGGTGAAGTCAGTTCTTCCTGATC
TCcGGAGGcATGAAGGCGATCTGGGACGAAGTGCAGGGCGCGTGCGACGCCGTGAGCGTGCAGCAGTCGCTCCAGACGACTACTGAACGGCCGCTGCTGC
TCGACGGATGGACGCCGCTGCACTTTGCGTGCGAGAACCGCTCGGTGGACGACGCAACGCGTGCGGCGTGCATCCGCGTGTTCGCGAGAGATCCCGGTAT
CGATGTGAATGCTGTTGATGAGGTATGTGGGTGAGATGGATGCaCGCACTGACGTT