Description :
From Genome Similarity Track
Location :
Scaffold_25:145536- 147368
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009291Similar to proS: Prolyl-tRNA synthetase (Aquifex aeolicus)

Sequence
1832 bases(100 bases per row)
CTACGCGCTGCGCTCGACGCTGTGGATCCCAACAGAGAAGGAGGTGCCCGCGGACGCCGCGATCCCGAGCCACCAGCTGCTGCTGCGCGGCGGGTTCATC
CGCAAGAGTGGCCACGGCGTGTTCGCGTTCCTGCCGCTCGGCAAGCGCGTGGCGAGCAAGCTCGAGGCGATCATCGACGACGAGATGGCCGCCATCCAGG
GCAACAAGCTCGACTTGCCGCTCATGATCCCCGCCGAGCTCTGGCAGCAGTCGGGGCGGTGGCAGACTCGCGGTCCCGAGCTCATCACGTTCGCCGACCG
CCGCGACGCGCTCCATGCGCTCGCGCCCACGCACGAGGAGAGCATCACGAGCCTCATGGCCAACCACTACAACCAGAACAACAGCGCGCACGGCGCCAAC
CATTCGCTGCGCGTCTACCAGGTGGGCAAGAAGTTCCGTGACGAGATCCGCCCGCGCTTCGGCCTGCTGCGTGCGCGCGAGTTCATCATGAAGGACATGT
ACTCGTTCGACACGAGCTTCGAGCGCGCGCTTGAGACCTACGAAGACGTCGTGCGCGCCTACGAGACGATCCTCAAGGCGCGCCTCAAGCTCCCGATCGC
CAAGGTCGAGGCGGACTCGGGCAACATTGGCGGCAACCTGTCGCATGAGTTCCACGTCGTCGCCGACATTGGCGAAGACGCGATTCTGTCCTGCGCCTCG
CACGAGTGCGGCTATGCGGCCAACGTGGAGAAGGCGTTTGGTACCTTGCCAGTTAGTGAGGAATCAACTCAAGAGCATGAGGTCACAAGTAAACTGAAGG
AGACACTGGCGCGGATTGGGCAGCAGGTGCAAGCAGGCGACCTGAACGCCTGGAAGCAGTTCCTCGCGCTGCCATCGCGCTCTGGGTTCACGTGCAAGGT
CCTCCGTGAGCGTCCGACATCAGACGATGACGACACGCAGCAAGACCAAGTCCTGCAGTACGCGATCGTGTTTGCACGTGAGGACCGTGAGGTGAATGAG
CTCTCGCTGAAGTCGTTTTTCAGCGATGAAGACCTTGAGGAAGTGAAACCTGCGGCGCTCAATGTGCTTGAAGACTGGAATGCCGCGTTCAAGGACAAGG
CCCAGCGGCTGCATCTCTTTTTTGACGATTCATTGGCACACGACGAGAGCAGCACTGTCGTCGTGAAAGCTCTGAAGGACGCCGCCCAAGTGCACGCGGA
CCAGGCGCTCGTAAACGTTCACCACGGTCACTTCCGCATGGCGCAAGAAGGCGATGGCTGTCCACGTTGCGCGCACTCGCACTTGGAAGCGAAGCGTGGC
ATCGAAGTCGGCCACGTCTTCTACCTGGGTCAAAAGTACTCAAAGCCCTTTGACGTGACGTTTACGGAGACCGACAGCGAAAGCGGCCAGCCCGTGAAGA
GAGTGATGGAAATGGGCTGCTTCGGCATGGGCGTCACGCGGCTGATCGCGTCGGCCGTCGAGGTCTCGCACGACAAGCACGGCATCATCTGGCCCGTCGA
GATTGCGCCGTACAAGGTCATCGTCATGGCTATCGGCAGCAAGACGGGCGACGAGCCGATTTCGCAGACCGCGATCAGCATCGCGCAAGAGCTGGCCTCG
AGCTCGAAGGCGACTGGGTTGAAGCGCGACGACGTGATCCTGGATGACCGCTGGAACGAGAGCCCCGGCTCGAAGCTCGCCGAGTCCGAGCTGCTCGGGT
ACCCGTACCGCGTTGTCGTCGGCAAACGGTTCGCGAAGGAAGGACTCGTCGAAGTGCAGACGCGCGCGACGCTGGAGAAAACGTTTGTAGCGCCAAGTGA
GCTGTTGAGTTTCTTTGCGGACAAGGTGGCAC