Description :
From Genome Similarity Track
Location :
Scaffold_114:145520- 150579
Sequence
5059 bases(100 bases per row)
CTGAGTCTTCCTCTGACTTAAGGAGCTGTGCAGCTCCACTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAACCACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGATCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATC
GCAAGGCCCGGAGGTGCTTACTGCACGTGTTGAGGGCTTTTGCAGTATGAAGCGTCCCTTTTTAGGGCAAGTCCAAGACCAAATGGCGTCGTCTATGGCT
ACACGCTAGGTGTCTGTTCTAGACGAAGAGGCTAGGTCTCGTCCACTTATAGTGGAAGTTAAAAACTACTCAGGAAAGGAGAGTGAAAACCTCATCCTCT
GGATCCGTGAGATTGAGATGGCAATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGA
ATGGGCCTTGACGTGTATCACGTCGGTCGACTTAGTGTTTTCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCAAACCAGGCT
TACCGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAGGAATGAGTCAACGGACTATGTCCAAGAGTTGAGAACTCTCATGGCTGCTATGCGGTCTG
ACCCTCTGCCTGAAGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTGACGTTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTACATTCGAAG
AGGCTGTGAGAATTGCTCTTAATGCTGAGCATAACTTAAGTCGGCTAGAATTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACGACACGAGT
ACTCCGGACGGTAATAGGCCGGAACCGATGGACCTCAGCTAAAGATGAAGGTGAAGTTGAAATTCAAGCTGCTGAGCAGCAACGTATTGTACGACGGTGT
TATACGTGCGGACGTACTAAACACTTACAGCCTGGTTGCCCTTTACGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGATCCAGAAGTCTGGCA
TGACACGGGGAAATGCCGATACCTAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTA
GCCCCAAAGAGTTCCATACCTATTGGTATGGAGCGTGAATACAAGGCTGGCTTGTTGGTCGCTAAGGCGAAGTTAAAGGCTTTGAAAAGCCTTGGTCGAT
TTTAATCGATTATGGAGCGTCTTGCAATTATACTCGACGTCGTTCTCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTCA
ATCACGGTTCGTTTAGCGACTGGAAGTCGTTTCACTGTACCTAAAGTTTCTTTGAGATTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGTC
TTGTCCTTGATGTGGACTCGATATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGGTTGATTGGAGGTCGAAGACCTTAGGCGC
TACGCGCAATGTTCCTCGTGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAAT
GTGCTGGACATTGGAATGTCTGAGTTAACTAAATCCAATGTTGAAAACATGAATTACGAGCGTAGCTCGTTGAATATTAGTGATACGGCACGTACTCCGT
TGATTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGTGAAGGCACCACACTTAATGTCGGTAATGACATCAGCGCTCGTATAGAGCGTACTAATACT
AGTAGTAACCACGGGGACACTATTGTCCTGACCCCAGAGGGGTGTAAGGTCTCAACGAAGAGACGACCGGGACGCCAGGTGGCAACTGTTAAGCGCCAGG
CTTCCGTGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGAAACCCTTCC
CTCTTTGGATGCTCTTTATGAGCTAGGCGAAATTTCTGATGGCGAGTTTAGCCAGACCTTGAAGGCAGGGGATTTATCCGAATTAGTGGTCATTAGACCA
GATGTTGTGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGATACCACGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATC
CTTTGGATTCATTCTATCCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCACAATCCACCATCTATCTTACCTCCCGATAGAGGTGTACGTCATGAAGT
TGAACTAGTTCCAGGAACGAAATACTGTGTAACACGGTAGTGGCCTTTACCTAAGGAACAGTGCGAAGTCATTGACGATTTCTTTCGTGCTAAGAACGCG
GCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTATGCACGCTTATATTAAGC
TTAATGCTACCACTATCCCGGCTCAGACACCAATCCCCAGCAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTACAGTGCTCTCGACTTAGT
CGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATCCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGTCACAA
GGGCTGTCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCC
ATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCAAATTGACCATTTACGAGCGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGCAAATGC
ATCTAAGTGCATCTTTGGTGCAGAAGATTCCCTTTCTAGGGTGCTTCATTGGGAACTGAGGCCTTCGAGTGGACCCCGCTAAGATAAGGGCATAGTCGAT
TGGCCGGTTCCAAAGAACCAAAAATATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGAGAATTACGCAGATATGGCTCGGCCAT
TATCCAATCTCCTTAAGAGGGATGTGGATTGGTGTTGGGGTAACACCGAACATGAGGCTTTTCAAGCAGTTAAGGAAAGCCTCCTTCATGCGCCAATACT
GGCTTTGCCCGATCCTGATCGGCCTTTCAGCGTCGTCTGTGATGCATCTGACTTTGCCATAGGAAGTGCTCTTTTACAAACAGATGTGGATAGACGCGAA
CGCGTCATTGAATTCGAATATCGACAGCTCAAAACTGCTGAAAAGAACTATTCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAAT
TCGGAGTACATCTTCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGAAACAGTCGCCGCATCTCTCTCAGAAAATGGA
TCGTTGGCTTTACTTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGACGCGCTATCGCGCCGATCTGACTAT
GAGCTTGCTCACATCACCACACTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTG
GGAGCGAGGAGTCTAAGGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACCTCGATATTCTATCGATAATGGCCTATTGTGCTATTGCAC
AGATATTGAGGATAACCCTCGTATCGATGTCCTTAATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTTTAAGTAGTCATCTC
GGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTCGGTGAGCACCTATGTGAGTACGTGTGAAACGTGTCAAC
GAGTAAAACCCTCAGCACATGCGGCGGCACCGCTGGATAGTCTGCCTGTACCCACCGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTAAC
GAAAGATTCGGAAGGCAAAACAGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGATCACCTAGCAGCAGTGCCGGACTCTATTGATGCCGAAGGT
AAAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATCGTCTCTGATAGAGATCCTCGCTTCACTGGCAAGTTTTGGAAGT
CCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGTGGATCATCCTCAGACCCATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACAT
TTTGCGCAGTGTTTGCGCTGATACTCCTATGCGCTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCGACAGGCTAT
ACTCCGTTCTATGCAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGTTTCAGGGATTGGTGGAAGAGAGTTGCCGATCGACTTGC
TGATATCAGCCCTGCTACTGTTCGAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGAAAA
GACAAACAGAAACAACAAGCACATGCTAAAAACAGAGATTGTATTGAACGTTATCAGGTCGGAGACCGGTATTACTCGATGCTAAAAACCTACCTACAAA
TGTAGTGTCCGCAGTCTTCAAGACAAAGTTGCGTCCGCGCTTCATTGGACCATTCACTGTCACTTCCAAGAAGGGACTTGCGTATACGCTCAACCTTCCA
CGCAAATTGCGCACACATCCGGTGTTTTACGTGGGCTTGCTTAAGCCGTATCGGGATCC