Description :
From Genome Similarity Track
Location :
scaffold_550:14550- 15999
Sequence
1449 bases(100 bases per row)
ACTAATTTGATTCATTCTACTGTACATTCCAATCACAAGTCGTAGATGCCGTCGATGTCCGATCCACATGAGTCTTCCCGTCATTGCAAGCACCCTGAAG
CTTCTCATCACTTGTCGCGGAGTCAGCTCGAAATTCTGACTTTAGCATCCCTTTTTCGAAGAACAGGAGGTCGCCTAGCTAACGATGGCCTTCGGACTAC
AACTTGGACGAAACAAACTGGTTGGGACAAAGTGTTGGAGGTTGCAGCAGCTCTCACGAACGGAGGAAATCCCATCCCAAAAACTGCAACGATGCAGTCT
TTCTTTCCGGACGTGTTTGGGGTGAAATGGGAACGCAACCACGTTGTAGCTCTCGATTTCTCGGAAAACGGACTCACAGGGGAATTTCCACTCGATATTG
TCCGCCTACGCTTCCTCATGACGCTCAAGATGCGAAACAACCAGCATCTACGAGGAACTTTGCCTCGAGAAATCTACTCGATGCCTCACCTCAAATATTG
CTATGTGGACGGCACGGAAATTGAAAAAGCACTTCCATTCAACATCGCTCACTCTTTCCAAATTTCTCAGTTGAAACTTAAATCCCGCAGATCTACGAGG
ACAACGAAATCGACAGTGAGCTTTTGCACGGGTGACGAGCGTTCTGGTAACACCATCCACTGGATGGCCGACATGACTGAAACGGAAATGGAAATGGTGC
GTTCGACACTCAAGAAATTGCACGAAGACGCTAATGGTCATAAAGGGCGTGAGCAGATCAAGTGCACAGCTAGTAACGCCACTGGACCTGAACGTGCTGC
AGCTGCTGTGAAGTTACAGCGCATCTACCGAGCTCGTATCGAGCGGACAAAGTTCCGAACCTTCCTCCGTTCGCTTGTCGAGATGAAAGTTGACCCTGCA
ACTGGATCCAATTACTACGTCAATGCTCGAACGGGAGAAGCAACTTGGGAAAAACCCAAGTTCCTTGCTTCCGATACTAAAGAACACGCAAATATCGACA
GTGATAGCGCGAGTAACAACGTGTTAGATGAACGAGAAGTATGGAAACCGTACGATGACGGCTACGGCAACACGGTACGTGGATATTATCTTACAGAAAT
ACTGGAATGTTCACTAATATTTTGCCAAACAGTACTACTGGAATAGTGTGACAGGAGAATCGACGTGGGAGCCTCCAAGCTTCCTTAGCCGCATCTACGA
AGAGCTCCGTGAACGCTACGGAAGTGACAAAACGGATGAAGAGCGGTTCGATCTCTTTTTCCAAGATATCGATCGTGATGGTACTGGGGAAATCGACCAG
GACGAGTTTGCTCGGTTGTGCGGCGACTTAGGCATGGCTTTGTCAGCCAAACAGATACAAGAGGTCTTTCGAGAGCTCGACACTAGTGGCGATGGCCAAC
TTGATCGTCCGGAAATCATCGCGTGGCTGACGCGAAACTTTAAATGAAG