Description :
From Genome Similarity Track
Location :
Scaffold_1260:1455- 4554
Transcript NameFunction/comments
Phymu_g13012hypothetical protein PHYSODRAFT_250215
Phymu_g13013hypothetical protein PHYSODRAFT_329272

Sequence
3099 bases(100 bases per row)
GCGTCAACGCGTTACCTGGTATCCACAGCTATGTGAATCGTGTCCTTGTTCGAGTCGCTGCTAAGTCAGGCGTTGCTGAGAAGTTGACGTCTCATTCGTT
TAGCCATGGAGAGTCCCAACACGCGGACGGAGCAGACATGTGCGTCCAGTGGATTTTCGATAGAGGAGCGTGGAACATGACGGCGGCGAACAAGGCTTTT
GTGTACGTCTTCAATACTCCGGCTGAGGACTACAAAGTCGGCAGAGTCTTGAGTAGCCACGACGCCGAGAAACCTGTCCATCTGCTGTCGCTGGATATCT
TCGATTCCGATACTCAAGCAAAAATTCGATGCGTTGCATCGTCACTCTTCTGGTCTTCGTTGGGTGTGGAGATGCCATCCTACAACATCAATCCGCGAGT
TCTCGACGCTCGCATGGCGTATCTGCTGCGCCACTATCCGTAATTGAAGCAGGTGAATGCTAGCGACCTTGCTGTTCAACGGATTGAAGCTTGCGCCTTG
GAGAAAACTATCACTTTGAACGAGCTTCTGGCTTGGTCATCACACCTAGCCTGTAACACAAGCACATCAAGAACCAAAGAGAGCACACATGCGCCAGAGG
CCACACCAGTCATCACAGAACATCCCATGTTTCGTCACCAAGCAGCGTTGATTGAGCAGTTAATACAATCAATCAACCCTTGACACCCGGCTAGCTATGA
AGGAGGCCAACGTCTATAACAAACAGCAACCGACAGCGCAAATCATCTAAGGATTCATGCAACGAACCACCAGCAAAACGACGACGTATCACTACAGCTT
CCAGCTTGAAGGATGTTTGGTTCACATGGTATACGCAAGTGCCACGCATGTGGAGCTCGACTGAAAAGGCGACGAAGCACACACGATCAACCGCCAAACT
GGTCGTCGCATTCATGAAGCTCTTTACGCCCAGCGGTTTCAacttggacgagaaggctgcgCAGTACTCCGACCAATTGCTGGCGTCTGGAGAATCAACC
GCGGTAGAGCTTCTATCCTCCCTTCGCTAACACAACAGCACTGCCCGGGGTGCTCAGAACGCGTTTAATTCCATGCGCACACTACACAAGAGTGGCCATC
TTAACGAGCATATTCGCCGCGATGAGCACCTTCAGACCACAGGTCGCATAATGGATCCAGCACCTACTTTACACAGAACATCATCGATTTAGCCTGACAC
CCGTAATTAACAAACTTACCTTCCGCTGTACACTAGTCATTCTTGTTTGCGATCTCTGCTGGCTCTGTGGCGCCcactcttcaatttcctTGTCCACCAC
CATGCCGTTGAAACCTTCCAAGAACGACATCAGCTCCgccaaggagttcaagaCGCTCTGCATTGCTGCTAGCAAGGTACACAAGCTTCGGGTCAGTGAT
TAAGCCAttcgtcatcgtcggctTACCATGAATATCGTTGTCATTTCTGCAAGCTTGCTCCCAGAAGCTATCAACGTGATCTTCGCCGCGCTCGCGGATT
GGACCAAGCGCCACGTGACTCTTGACGACGTGCGTGAGTGGCTGGCTGAGCCTCCCCcagctgacgacgatggcgaagatgaagcggtgagaagcagcac
cacgtgCGCAAGCtgtggaactggaagcgcgtCCGGGGAAAGGCGAATTACCTGGCCAACTGGGAGCCGACGTGGGAGTCTCGAGTGTACGTCAGCCCGT
CCGTTGTCGCTGCCTTCGAAAAGGAGCGCCGCCTGCTTGCCCGGAACAAATTCTTCGAAGTCGAGGCTGTGGAAGATAACACGTTCAACTAAACAAGAAG
GTAGGTGAGCGAAGCAAGAATAACGAGCCAATACGGAGTGTGTTTGATGCTTAAGACACGGAGGTAGCGCCGTATGCGATAGTATAACCGATCTGAGCAC
CAAGCTTAACCTCCATACGGAACGACAAGGTTAACCTCATCACAGAGTAAACCAGCTTGCACACCACAGAAGTAAAGGCAGCTGTACATACAAACAAATA
TACAAGCATACAAAGTCACTATGTACATCCACGGTCGAAGGAAGTACCTGCGCCTCagggaaaaaaaaatgagaATGACAGGGAATTAGTTAGCGGAAGC
CGCAGACCAACAGATTAGAAATAACCTCGTTTCTGAGGTTGTAACCACATCTACAGGTAAATACCGTTGCAAAAACCTGTAAAAAGGCCGATTTTTTTTA
TCTGGTCATCATTGCTGAATTTGCCATGAGGCGTGAACATGCCTCACGGAATTTATTTTACCTTAAAAAAATACCTTTTTGTTTTCGGCTGATTTCTCGA
CCCACAGGCCGTTTCAGACCCAGAGAATCCGGCTATAGAATCGATGTTTTGCACAGTGTCTGGACACTCCGATCTTAATTTTAGCTCCCCTACCCGCTAT
TGTACTGGCAAGATGAAATGCTCcataaaaaatatatttgGCCATAAAATTAAAACTAGGAAACCCATGAAAAATATAAGAATAGCGGGATAAGCACCGA
CACATGGAGAGCATTGCTGCTTGCATATCGCAGTCTCATTCCCAGTTTACCTCCGCTATGCGGCATCTAAAGGCCTACGAAAAAATGCACATCGTGCGAG
CACACGAGTACTTTGTGCAAGAAGCACGCGAACGTAGGGACCCCGATTGCCGACCTATACGTCAGCGTGTAGCAGACTGTCTTGCGATAACAACGGATAT
GGACAAGCGCACAATGGCGCACTGGAGAAAGCACCACGACGAAACATTCACCGCCGCCACAGCTCCTCGAGAGAAACCTCCACGGTCAGAGATTAGCCAA
CTTCATCAGATGATTTCTGAAATTATTGACGAGCCTAATCATTCGAAAAGACCGACTACGTCCAACATTTTAATTTCCgaaatacaaaaaaaaaacaggt
ACAGCCATACCCGCCGGAACTATGCGACCGGAATTGAATCGGATGGACTGCAGCTTTATTCGAGGCCAAGCACGTGATCCGCGCGCCGATTCAGAGGGGA
ATATTGGATTTCGACAAGTGTATTTGCAAAACAAAGTTTCTAACTTAAATGCGCGCGGACATCCTAAACTTCCAGATGTATATTTGGACAACTATGTAG