Description :
From Genome Similarity Track
Location :
Scaffold_1886:1455- 2799
Sequence
1344 bases(100 bases per row)
CAACACGTAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGTCTTGTACTCGACGTGGAAGTTGTACTCCGCGAAGAAGGACAGC
CATCTCGTCATTCTATGGGAGAGGTGAGGCGAATTGGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGACCGGGAGCCCAGAAGGTGAA
CACTAAACTTCACAAGGGCATATTTTATTGCCGGGGGCTCCTTGTCATGGACAGGGTAGTTCCGTTCGGTGGCTTTGAGCTGCCTGGACTGGAACGAGAT
GACTCGTTCATGTCCAGCCGTGTCGGCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGACTTTGGCTCGTCCGGC
AGGGCCAGGACAGGAGCCTCTTGGAAACTGGCCTTGATGCTGTCAAAAGCATCCTTGTGCTCTTGGCCCCAGCGCCAGTCGACATCCTTCTGAAGGAGAC
TCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGTCGT
CGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCCAAAATG
CACTTGTCGATGTTGGCGTAGAGCTTGTTCTCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCGCCCTCGG
CACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTT
AGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGTATCAGGATTTGGTAG
TATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGTGAAACGGTGTTTGGGCCGGCACCGTT
GCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCA
CCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTCCCTCGTGACACAATACTTTGTGCCGGG
CACGAGATCAATCTCGTGCCGTACACCTCGATCCGGTGGGAGTT