Description :
From Genome Similarity Track
Location :
Scaffold_84:14549- 16654
Transcript NameFunction/comments
Albla_Nc14061390myosinlike protein putative

Sequence
2105 bases(100 bases per row)
GTCGAAGACATGTGCGATTTGTATCATTTACATGAGCCTTCTATAGTTTATAACCTCCGACAACGTTATCTAAAGGATATCCCGTACACGTATACCGGTG
GTATTGTGGTGGCTGTGAACCCATACAAATCGATATCTCACCTGTATACGAAGGAATTGCAGGATGTATACACAGTCAATAATCGATCCACGCTTCCTCC
GCATGTCTATGCAACCAGCGCGCAAGCGTACAACAATATGCGACTTGGAAGAGAACCTCAAAGTATCTTGGTCAGCGGTGAATCTGGAGCTGGAAAGACC
GAAACAGTCAAGATTCTCATGCAGCATCTCGCGAGCATTGATGTTGCAACAAATGCTTTGTCTCCAGTCCCGCAGCGTGACGCTATCATCGATATGATTC
TTCAAAGTAATCCATTGTTGGAAGCCTTTGGAAACGCAAGAACTGTGAAAAATAATAATTCCAGTCGATTTGGTAAATTCATCCAACTTTCGTTCAACTC
AGAATTTCACGTACTTGGCGCCAATTGTCGTCATTATCTGCTGGAGAAATCACGTGTTATCCATCAAGCACCCGACGAGCGCAATTTCCATATTTTCTAT
CAATTGTGGAGCCAAAAAGACCCGAGATTCCATTGGGAAGACAATCTACAATTTCGATACCTTCGGGGAACCTTCGAGACCTCGGATTCGGAGCATTTCC
ATCTCACAAATTGCGCTCTCCAGACAATTGGACTGAGCATCCATGATCGAGACGCACTTTTTGAAGCGCTGGTAGGTATCCTGATACTCGGCCAGCTTCA
ATTCACCGAGATTGAGTCTCCATCGAGTCAGAATCTCCAAATTCCTCTGCAGGTCGAAAGCCTTGATCCGACTGGAAATCTCCCGTCATCCTCTCCTTCC
GAGTGTGAACAGCTCCAACGTTGTGCCAGCTTGCTTGGTTTCACAGACACTCTATCGACATTCTCTCAACATCTTTGCAATCGCACCTTCAAAGCTCGCC
AGGAAGTCTATTGCATCGCTCTGAGTCTCGATCAAGCCAAATATCATCGAGACGCATTAGCCAAAGAGCTGTACACTCGAATCTTCCAGTACCTCGTGGA
TCGCATTAATCAAAGTCTTCGATCACCCACAGCATCGCATTCGTATCGTCAAATCAATCTTTTGGATATTTTCGGCTTTGAGGCGTTGGAAATCAATGGT
TTCGAGCAATTTTGTATCAATTACGCGAACGAGAAATTGGAGCAGAAACTAATTTCCGATGTGTTCAAGGCCGTGGAAGAAGAATATCGTCGAGAAGAGC
TTCCCTGGAGCCATATTGCGTTTCAAGATAACCAAGACATTCTCGATTTGTATGAGAATCCAATGGGACTTTTGTCGCTCTTGAATGAAGAATGTGTGAG
ACCGATGGGCTCCGATGCTTCCTTTGCGTCTAAAATCCATAGTTTCCACGCTGACAACCCGCGAATGGAACGTGCAGGTCCGAAATACTCTGCCAATCAT
TTCGTGTTGCATCATTACGCTCAGAGTGTGATCTATGACGTCTGTGATTTCGTGGAGAAGAACAGAGATGGCTTGTCTATGCATCTGGTGGAGTTGTTGG
GATCGAGTCGGAACACTTTGATCGCTGAATTGTTTTCTGGAAGAGCGTCTGATGTCTCTGAACTCTCCATTCCCGACGCGGAAAGTGGCATAATGGCTCG
AAAATCGTCCAATTTCATGCAAGAGACTGTGAGCTTCAAGTTTAAGACGCAACTGAGCGAATTGATGCAAGTGATTTCGGCCACCAATGTCCAGTACGTT
CGATGTATCAAGCCGAATGCCAACAAGATTTCTGGGCATTTCGATATCAAATGCGTCATTCATCAGCTCCGATCCGCGGGAATCGTTCAGGCGATTCGGC
TCACTCGAGAAGCGTTTCCCAATAAGATGACACATGAGCGATTCCTTGTTCGATTTGTGTTGCTCATGAAGCGGTCGAGGGTGAAGGACGTCGAGGGAAT
CGTTGAAGCGTGTCGAAATTTGGGCAATCAGTTGATACATTCCAAGAGCTTTGCGGTCGGGAAGACGATGATATACTTTGGCAAAGGCGTGTTGGAAGCG
TTGGA