Description :
From Genome Similarity Track
Location :
Scaffold_86:145476- 147227
Transcript NameFunction/comments
Phyra_83324anoctamin-like protein

Sequence
1751 bases(100 bases per row)
TGGGTCACCCAGCACGCGGACTTCAGGAGTCATGTGCTGCCTCTATCGGGCGCGGCGCAGTGCCAACGACTGTGTAAATTGATCTTGACCGAGCTCAGGT
TGCAGCTGGACGTGTGCTGCTTGCACGCGCAAGGGCACGGGAATGTTCCTGGCGCACCGGTGCTTCTGAGTGCACGAGAGAAGCTGCTGCCACAGGTGAT
GAACGCCAAAGGGCTCACAAATGTGGCGCTGTATCCGCTCCATCGAGACGAAGCGAGGCGGCAGCTGACGAGGAGATGGGGTGCGCAGAGCTCGTTGGCG
CTGCCGCCGCTGGAGGATATTTACGCGTACTTTGGACCGAGGATCGCCATGTACTTCGCGTGGCTCGCGTTCTACACGAGGATGTTGCTGCTGCCGAGTG
TCTATGGGGTTGTCGTGCACGTCCTTGGCATGCTGAATTTGGCGCCGAGTTATACCGTGCATTGTGTGCTGGTGGCGATTGGGACCTCTCTGATTGCGGA
TATGTGGCGTCGCCGACAACGAGAAGTGGAATTTACGTGGGGGTATGACGGTGTGTTGTCATCGCTGCACGCGACAACGCGGATGCAGTTTCAGGGCGAG
TGGATGCAGGATCCGGTGACTGGTGCTCGGTGTTTCGACTTCCCGCACCACAAGCGGCTTCTTCGGCAACTTTTGGCTGTTCCACTGCTGGTGTCCATGT
GCTGCTTGGTTGGTGGCTATGTCATTGGACTGCATGTGCTCTCAGAGCGTCTACGAGCGAGCTATAGTGAAAGCTGCACCCAGGCATGGGCTCAAACGGA
GCATATCGAGACGGGTATCGCTGGTACTGGATATTGGAGTTACGTTGCTGATAACTGGATACCAAGTAACGACGCAGCAACGTGTGCATTCGTTTCGCAC
GGCCCTAGTGTGATAAATGCTGTAATCATCTACGTCATGGACAACCTGTACCAGTTGCTAGCACGGAAACTTACGGAGTTTGAGAACTATCGGACGCTCG
ATGAGCACGAAGCGCATTTGGTGGCAAAGAGAATGCCGTTTCATCTCGTGAACAGCAACGCGTCTCTGTGGTTTCTCGCCTTTTACGTGCGAAGGCTGGA
TCGAGTTCGTGAGCGTTTGTGGATTTTGCTGGTGGCAACGCAGTTACTCGACAATTTCAAGGAGGTAGGACTTCCACTCGCTGTGTCGGTGGGTGGGCAG
GTCCTTACCGCGGAGAATAAGCGACGCCGTCGGCAGAGTCTTGAGAGCCTTGAGAGCGACCTCATTGAAGAGAGCCACCGCCTCCAGCGAAAAAGCTCGA
TCCCTCAACTGAGAGCCAAGCGGGAACGGGAACGGGTGGATGTCGTTAAAGCTGCTACTGAGCAGCGGTTAGCACGTGTGCTTATGCAAAAGCGGCAAGC
TACGTACCGTGACTCCTTCGCGGACTACAAGGAGCTCATGGTGCAATTCGGTTATGTGACTCTCTACAGCCCAGTATTCCCACTGGCTGCAGCATTCGCT
TGGCTGAATAACACGATCGAGAGTCGATCCGACTTGCTCAAGCTTGTGAACCGACACGGCTACCAGCGACCGGTTGCCCAGCACGCACGAGGCATTGGCG
TATGGGAAAAAGTGCTCGTGAGCTTCGCAGGCGTGGCTGTTGTGGTCAATTGTGCGCTCGTGTGGACCTACGAGCTTGACGAGCTTCTGCCAACGTGAAC
GGATCTTCAGCGCCTTGCCTTCATCGTTGCCTGTGAGCACGTGATATTTGT