Description :
From Genome Similarity Track
Location :
Scaffold_509:14542- 18451
Transcript NameFunction/comments
g9560.t1XP_009525871.1 hypothetical protein PHYSODRAFT_502439 [Phytophthora sojae
g9561.t1XP_008906610.1 hypothetical protein PPTG_12133 [Phytophthora parasitica INRA-310
g9562.t1hypothetical protein
g9563.t1hypothetical protein

Sequence
3909 bases(100 bases per row)
AGTGAACGTGCTGTGCCGCATGCACTGACCTAGGATACTTACGCCATATTATTGCTCTGTTGTTGTAGATTTATGTGGATCGCCAGCTGCACAACCGCCA
GATCTTCCCGCCCATTAATGTGCTGCCATCGTTGTCGCGTTTGATGAAGAGTGCCATTGGTGAGGGTATGACGCGCGACGACCACAGTGCTGTCTCCAAC
CAGCTGGTAGATCGATTTACAGTGTGGGGTAGTAAGCCGCTACGGTCTAGCTTCTCACCGTCCGTCTCGATTGCTTGTGTGCACAGTATGCCAGTTACGC
TACCGGCAAGGACGTCCAGGCCATGAAGGCCGTGGTTGGCGAGGAAGCCCTTTCTCTGGAGGACCACCTTTACCTGAAATTTACCGACAAGTTCGAGGGT
AAATTTATCGCGCAAGGCCCGTACCAGTCGCGTGATATCTTCGAGTCGCTGGATCTGGCGTGGTCGCTGTTCCGTGCCTTCCCGAAGGAGCTGCTGAAGA
AGATCCCGAAGAAGCACCTGGACACGTATTATGCTCGTCGGACGCAAGCGCGTGAGGAGAAGGAAGAGGTACGTCCTAAACACCCTCTGGAACGTAGCGA
GTCCCGATAGCTGATGTTTCGATCTTTTCGTGTTCGTGACCCGAAGTGAGTGAGCACGTCATGCCTGTTTGCGCCCTGCTCTGAAAGGCTGGGTGAAAGC
ATTTGTGCCAGCTGCTGCAATCGCGGCAACGAAGAACAACTACCGGCGGCGAGGCTTGGGGCGTCGGCACCACGCTTTTGTCTTCTAGCCCTGCATTCTC
TCCATGTTGTTCCACTGTGCTGAAGAAGAACTCAAGTAAATGAGAGCTGCTTGGAAATTGTTTTAAGTTACTTGTTCGGTAGCGGATTGCTTGCGTCTCC
GTCGTTTGGATGGCACTGATTGTGCAGGCTGCCACTCAGGATCTGTATGTTGGAGAACGAGACGGCACTGTCGGACGCTTAAGTGGCGCTTGCGGCACGA
TTCACACATGCGCTTGAACTCTGGTGTTTGTGCTGCACGATACGGCGCTGTTAGCGATGCATGAAAGATGGCGAGAGTGAAGCCAATGGACTCACCTGGA
GGACGAACGGACACTGTTGGCCGAGCTGGTAAAGCCGCTTGCATAGGCGGCTGCCACGTCGGCATTGGCATGAACCCTCCGGCAGCATGAGGGTTGAACA
TCAGAGGAGCAAAAGGCATATACATGCTGTACATGTGTGCCGGCGGCAGCGCAACCTTGGTGCTTCCGGCTGTGTTCGGCTTGATCCGCAGATCTCCAGT
AGCAGTAATTGCCATGGGAAGAGGTGGCGGCGGTGGGAAAGAACCTGGCACTGGAGTCATTGTAGACACGGCTAGCGGATTGGCCAGTAGCAAGTTCATT
GGCGCTGTGGGAGGAGGAGGGCCCGCTGCAGCCTCTGTGGTGGCTTTCACGAAAGCAGCGATGTGCTGGTGCGCGCGTAGCTGGTTCGCCAATGCCAGCC
CTCCGTGTCCTTCCTCTTCTGCATTCGCTCCTGGTTTTGCCCGTGGAACCTCCAACATGCCGTTCGTATTCTCCTTCATGATGGCACTGACGCCTTCCTC
CTCGAGCACCTGGTGCCGCGATTTGACCCACTGCTCCTTCGAGCGCTGGGTCTCGCGCTCCTTTTCTCCATCTTCAATGGCTTTCAGCAGTGCACCTCGC
GGCGCTTTCTCCGCCAGTCTCTTCTTGGGCTCATCAACCTTCTCTTCGGTGGTTGTAGATGCTTCTCCATCTGCAGACGCAGTAATCAGGTCCACCACAG
CAGACTGCTCCGGTTCGTCGCTCTTCGTCTGAAACACTCGCACCCTACTGGAGGCAGCGACTAGACTACTACTAGTGCAGTTACCATTGCCGTAGACACC
GAACATCGAGTCGATGAACTCCGCCATCTCCATCAAGTCGCGGTGCAAAATGCGCTGGTAGCTACACACCAACGACATCAAGTCAGTGGCACTAGGGACC
CTTTTGCAGATTTCTATGCGCCTGCTGCACTCACGCGATGAGGCCTTCGACGTCCTGCTCTGCTTGGCACTCGGCCGCCGCGACGATCATGTCCTCATTG
ACAGTTAACATCTGCACGGAACGAGCTGTGAGACTCGACGCTGCATCCAAACAGAGAGCCACGTACGTCTACAAACACGTCCGAGATGGAGGATGCACCG
CCGTCCTCGTCGTCCGCCGCAGACGCAGGCGGCGACTTCCAGCGCGAGGCGCTGCTGGCCATGGGGCAAAATTCATAATGGCGCGAGAAACTGATAGGGG
CAAAGACACTCCTAATAGAGGACCCTATTGTTGGCTCGATTTTGCTACTGTCCTTGAGCAGCCTCAAATGGCAGTAAATGGAGCTGCATGCACGAGTAGG
GTGAAGTCATCACGCCTCGACTGCCAAATAAATACGCTGTCTCTGTCTGTCTGGCGCTAATCACGCCTCGAAGTCGCTGTCGGAGATGTCCTCGTAGACC
CACTCGTCGGCGTCGCCTTCGACCGCGAACAGTTCTCCTTCTGCTCGACGCACAGGGCGGTTAGCGCTCAGATGGTCATGATGCAACCAATACCCATAAA
GACAGCCGCTCACCGCTGCACGTTTCCCAGTCGGCCATGTCGGCGGCCAGTCGCTCGGCCTGTGATCGCGCCGGTTGCTTCTTCTTCTGCTTCTTCGCGT
TCGGCTTGGGTGGTGCCTTTGGGCATGTATTTAGCTTCCGCTTCGCAGTTCCACTTGTCGACGACCACACATGTGCACGCTGTGCTTGTCGACTTGGCCT
CGACGCAGCAGCAGTGGTGGACTGTCCGGCCTGCACGTCCGCGAGCTCGCTGATCTGCGAGAGCACGTTCAGCTGCGACGCGGGCGACAGCCGCAGCTCT
GTGCGTGAAGGCCGCAACGCTGAACGTCCTCTTGAACCTGCACGTGCTCCACATCAGTGCTCAGCCATTAGGCATCAATGAGGCAATGACACAGATGCAC
GTACTCGCAGGGGTTGAAGCCTGCAACGCGCAAGGCTCCGCTGCACCCGCATCCTCCTCAGCCGTATGTCTCTCCCTCGCGTGAACTGCCGCGGTCCAAA
CGCACGGAGACAAGGATGAGTCCTCCTCGTCGCCCAGTACAGTCTCGGCGTCGCTGCTGCAGGGCATCGTCACTCAAGTTGAAGTGGCTGGACACAAGTC
GCACTTAGCGTAGTGGGTTCGGATTATGCCTGGAACTGCGACACAATCCAATCCGCATTATGGAGCTGCGCTTCCGAGGCAAGAAGAGTGCAGAGGACGC
GGACACCGTCGCGTTCTGGTAGGCTACAGGTCGCAGGAGCGAGCCTCGTGTGTGTATGCCGCTTACTGACTGGGTCGCTGTCTGCTGCAGGCTGTGCGAG
GGATCGAAGAAGCGCCGCGTGCTGGGCAAAAAGTCGCTGCCGCTGGCTTTGGCCGCCGCCGAGTGGGATTTGCCGCACGTGCTAGAGAACGAGGAGCTGC
ACTGGATGAACGAGTCTACGGGCCTCGTGGTGCCTCGCGACCAGGAGCTGGGCAAGTTCGTCTCGGATAGGGATGTGGTCCGTCTCTGCTCGACGCAGGA
GCTTGGCGCGCTGCTGGACAAGTTTGCCACGCGCGACCAGGAAGTGGCGGCGGAGATGATGCACCCCAAGGCCCTGACACCCATGAGCGCGGCTCTGTGA
GACTCTTTGCGTTGCTGCTGGGCTGTAAATGCAGCAGTGCTGACAAGTTTTGTATTGTCTGTGGTGTAGATCGCGCCTGAAGAAGATCAGCGTGACGAAC
CCGACGCTGAAGAAGCTGCAGAAGACGCTGGATGAACGCACGAGTCCTCATTCTACGACGAAAGTCAGTGAGGAAGACGCACTGGATCAATCTCCAGAGC
TGGACCCGA