Description :
From Genome Similarity Track
Location :
Scaffold_2046:1454- 3014
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2046-snap-gene-0.6Heat shock 70 kDa protein, mitochondrial
Pytar_ATCC12531maker-par_contig_2046-snap-gene-0.3NAD-specific glutamate dehydrogenase encoded in antisense gene pair with dnaKJ

Sequence
1560 bases(100 bases per row)
GTCGGCCTCAGCGTTCATCTCAGCCTCCTGGACCATGCGCTCAATGTCGGCGTCCGACAGACCACCGCTCGACTGGATCACAATGCTCTGCTCCTTGCCC
GTCGACTTGTCACGCGCACTGACGTTCACGATACCGTTGGCATCAATGTCGAACGTGACTTCAATCTGCGGCACACCACGCGGGGCCGGCGGGATACCGA
CCAAGTCGAAGTTACCGAGCGACTTGTTGTCAGCAGCCATCTCACGCTCGCCCTGGAGCACCTTGATGCCGACCTGGGTCTGCGAATCAGCGGCCGTCGA
GAAGACCTGCGACTTCTTGGTCGGGATCGTCGTGTTGCGCGGAATGAGCTTGGTGAAGACACCGCCAAGCGTCTCAATGCCGAGCGACAGCGGCGTGACA
TCAAGCAGCAAAATGTCCTTGACGTCGCCGCGCAAGACACCGCCCTGGATGGCCGCACCCATGGCCACGACCTCGTCCGGGTTCACACCCTTGGACGGCT
TCTTGCCGAAGAACTCCTCGACCGACTGCTGCACCTTCGGCATGCGCGACATACCACCAACAAGAATCACTTCGTTGATGTCCTTCTTGTCAAGACCCGC
GTCCTTGACACACTTCTTGCACGGACCCATGGTGCGCTCCACGAGGTTGCCGACGAGCTTCTCGAAGGTTGCACGCGTGATCTTCATGTTCAAGTGCTTG
GGGCCCGTCGCGTCGGCCGTGATGAACGGCAGGCTGATGTCGGTCTGCGCCAGACCATCGAGCTCACGCTTGGCCTTCTCAGCGGCCTCACGGAGACGCT
GCATCGCAAGGTTGTCACCAGAGAGGTCAATGCTGGTCTCCTTCTTGAACTCGGTCACGAGGTATCGCAGCAGCTCCTCGTCGAAGTCTTCGCCACCGAG
CAGCGTATCACCGTTCGTGGCCTTGACCTCAAAGACGCCGCCCGAGATCTCAAGGATCGACACATCGAAGGTACCACCGCCCAAGTCAAAGACGGCGATG
ACCTTGCCGTCGGCCTTGTCCATGCCGTACGCGAGCGCAGCGGCCGTGGGCTCGTTGATGATACGCAACACATCGAGACCGGCAATCTTACCGGCGTCCT
TGGTGGCCTGACGTTGCGAGTCGTTGAAGTACGCCGGCACCGTGACGACGGCCTGCGTGATCGGCTTGCCGAGGAATCCATCAGCGGTCTCCTTCATCTT
GGTGAGCACCATGGAGCCAATCTGCGACGGCGAGTACTTCTTGCCCTTGGCCTCGACCCAGGCGTCCTTGCCGTTGGGGCCAGCGACAATCTTGTACGAC
ACGACCTTGGACACTTCCTGGGTCTCCTTGTCCTGGAACTTGCGGCCAATGAGACGCTTGACGGCGTAGAATGTGTTCTCCGGGTTGGTCACGGCCTGGC
GCTTGGCGGGCATGCCCACGAGGCGCTCTTCGTTGTCGAGGATCGCGACCACGGACGGCGTCGTGCGCGCACCTTCGGCGTTTTCAATCACACGCGGCGT
CTTGCCCTCCATCACGGCCACGCACGAGTTGGTCGTGCCGAGATCAATGCCAATGACCTC