Description :
From Genome Similarity Track
Location :
Scaffold_2662:1454- 2560
Sequence
1106 bases(100 bases per row)
AGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGCCGGCCACAGGC
TCTTCCGACACCTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGGTTTCTGACCGAACAGGGTATGAGAGCGCCCGTGCCACAAGCGC
AAGTGCTCCACGAACATGGAGCACGAGACGTGGCGATGGAGTCAGTGGAGGAAGACAACTCCCATGATGAGTTTGTGGTGAAGTGCTTTCTCAGAAATAA
GAGAATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGTGGCACGGATGCAAGTTGCCTGTGGT
GGATTAGCCATGACGAGCGGCACCCCGTATGGAATGACGATGGATCTAGTATGAGCGATGTACAGGAAGACAAGATCCACCAAGTCTTATCTCGGATCCA
CCCTTACCTGGATTCACTTAGGTGGATATGGGATACACTATGTACCAGTGGATCGAGTGGGGATCCTATGAAGGAATGGTGGTAGGTGTCATCCGAAGGT
GGATCTAATAGCCACGGCTAACGAGGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACCTCCGAGTTCGGATCCATGGAGGAAGGATCCCGCCTT
GAGGGACCTGGATCCAGGGTATAGGGATGATGGATGCAGTGGATCTCGAACTTTCGTGGGACCAAGGAGATCACAGAAGGTTGCAAGATGATGTTGGATG
ATTGGAGAGCTCGGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATG
ATTACGTCATGGATCCGGTGGATCTGAAGATACCACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTGGCAGA
TGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAG
AACCGG