Description :
From Genome Similarity Track
Location :
Scaffold_13:145354- 148021
Transcript NameFunction/comments
Phyra_75477Hypothetical protein

Sequence
2667 bases(100 bases per row)
AATAAATTTTACTATTCTACGCTAACTATTTGCTAAATCTCAACTCACATTGAGCACAGCAGTGAGCCGCATACTACCCTGAGTAGACTGAGGGACCCAC
AGCAACAACGAACCACCTCCTGTACCGGGGAGACCCATAAAACCCGGACGCCACCGATCCAAATACAGCGTCTTGCCTCCCAGCCTCGTCACATTTGATT
TCCACATCACGGTCTGTCCAGCTGGAACGGGTACCTCGGCGACCTTGTCGCCGCCAGACTTGATGTTCACAGACACATCCTCGGTGTCAACGCTCTTGAA
TGTGACGATGACAGTTCCGTCGCCCTCCTTCTTCCACAAGCCGTCACTATTATTGAAGGCATCTTGCACAATTGTCATACCCAATGCTTTCTCCGCTGTA
CCGTCATCAATCTCACCGATGAGCTGTGTTGGGCCACAAATCGGCTGGAAAAACTCGGAAACAATGCCCGTGACAACCCACATATCCCAAATGGCATAAA
ATCCAAGGGCTTTGTCCGCAACCTTGAAAGCGTATTCCTTAGCACTAAGGAAGGTGCCATTGCTGCTCGTTCCTGAGCTGATCAGATCATCCATGATGCT
TGCAAACGTCTTGCGAAGGGTGTCGCGTGTGGCGTAGGCTGTTTTTTCGTCCGAATCCGCGATCAAATCGTTCATACAGTTGTTTGTCGCGATGGGGATA
TCCTTCAGCACCAGGTTCGATTGACTCATGGCCACGCGAATGTCATCTTCGGACATTCCCGGATTCGTTTTAAGCAATTCAGCCACGGTCATCCATGTGC
GATCCAACAGGCGCTTCATATCATATCCACAGGTGGAGTTGGACTCCATCGCGGACTTCAAACTGGTGATGTCGAACTGGTTTAACGAGCTGATCGATTC
ACCGAGCGTGATGTTCTTCATGAACGATTCGAAATTGTCCCAACTTGAAACAATAGTATCGGAGTTTTTGACGGCTTCTCTCAGAATGAACTCTGCCGTT
GTGAGCACTCTGTCTGCAAACTTGACGCTGTCAGACACTTTGATCCCAAGACAGTAGGCTACTGCTACGGGTATGTCAATAACCACGTTGTCCGTCTGGT
AGAGCACTGCAAGAATCTTGTCTTGTGTTGACTCGGGGTCAGACACCTTGGCGTAGCGGATGTACTTGACCAGTGACTTGGTCAAACCCAGCATGCTCTT
AACGCACTTGAAGGCCTGCTGAATCCCTTTTGCCACTTTATAGAAAGCGCCGAAAAGATTCATCGTGACGAAGGACATTGTCGATTGAACCACCGTTCCA
ACCTTGTAAGCAACTTCCAAAGCACAGTCGTCGTTCTGCCGGATGCACTCCAAACCGCATTCGACGGGGTACGAATACGGACACTGCGCCCAACACATCC
CATGTTCGCTGTTGAATCCGAGCGGACACGTCTTCGCAATGTGAGACTCTCGATAACACACCGAGGTGAATGAAGTGTCGAGCTCGGAGCCGACCCAGTT
GACGTACGTTGCCTCGATCGTACTGGTAGCGTTCATCACACTACCCGTCGTGAAAGCCACGCTCATGGCGTTCGAGGAAGCAGAAAAATCACTCGACCCG
GAGCCAGATACAGTTGAAGGCACGTCGTCGTCGCTGTCACTCGCTTCGTTAGGACTAGTTTCAGATCCATCTTCATCATGTTCGTCACTGCTTGAAGAAA
GTGCGGCTTGAATTACGCTGTCGGTTGAGTCTGCATCATCGCTGTCTAGAGAATCGTTGTCACTTCCCGATGACTTGAAAGAGATCTTGGTGGACGTCAA
CGCGCCAACGTCCGTGATATTGTCAATGTCAATAGCGGCCGTCACTGTAGCAAGCGGAGTTGACGTCCTTGGCCACTCGTCCAGTGTTAGGATCTTCGCC
GAAGCGATTCCAACAAGTAATGCAGCGAAGACGGACAAGAGCATTGTCACCCTGGCCATCTGGATGGGTCTCGCGTCAGCGAGGAAGCTTGTTGAGCCTC
AAGTGGGACGAAACAAAGAATGAGGTGGTCGAGAGTGAATTGTTGAAACCTGCTCTCCGAAAACGAGTTTCTTTGTTGCAGTGTTTGTTGGTTACCGGTA
CTGGACAAACGATCTTGTGCTGTGTCGGGTCACAACGGAGGGCGACTGCCCCGATTTCGCCAGATGAGCATACCGTGTTGTAAATCAGTTCCGGTGGACA
TGTACGTGTACTGCAGCGTGGTACTTCCCGTCTTCAACAATGCCACAGCAAATTCTTCCAATCATGCCCAAACCGTCCGCGGACTAGCACAGCTCGGCGC
CATCCTACCATCTGCCTGCGGAGATACGACCACGCCGCGTGCGTCATGGATACTTTGTGATGCTCTCCTCCAGTCGCCTCCCCAGCGTTCCTGCTTGCTC
AAAATATCTCCTGTGTAAACTCAACGAGAGACGCCACATCTTGTGACGTGGGGTCTGTCGAGATCTGAACGGGGATTGGCATGCCCGTTCTCAAAAACGA
TGAGGCGCGTAGATTAGCTCGCAGTCGCAAATTGCGACCCGCAAACGCGTGGATTGCCAGTGGTTTGCTGCGGCTGCTACATGTACATGTACAAGATTTC
GTGGTGCTGTTGTGGGAGCGTGTTGCCGATTTGCGTTGACCTTTCCGCTGTTCGATAGCCAGCTCGA