Description :
From Genome Similarity Track
Location :
Scaffold_21:145353- 146837
Transcript NameFunction/comments
Physo_321890P-type ATPase (P-ATPase) Superfamily

Sequence
1484 bases(100 bases per row)
GCGCCTAGATCCCCTACGTCAACTTTGAGGACCCGCGGTTGTTTAACATCTTGGAACGGCCTATCAATGACGACACGCCGAACCGTGAGGCCGAGTTTTT
CCTGCACCTGAGTCTTTGTCAGACTGTGATCCCAGAGATGGTGGAGGGCAGCTCTGAGGTGCGTTTCTCGGTCTCTTCAACCGATGAGCAGGCGCTGGTG
TCGGAAGCCAAGTTCATGGGGCTTCAGTTTCGAGTCTCGCGGTCTAGGTGTTGCTCGTGTCCGCGTGAAGCGTCCGGAACTGATTCGCCGCTACGCGAAC
GGTGCTACAGGCTCCGACGTACTGCTCGAGTTCAAGATTCTGGCGTTCACGAGCGACCGTAAGCGCATGTCAGTCGTCGTGCAGTACCCCCAACGGCGGG
CTCACTAAGGGCGACGACAATACCATTTATCCCATGCTGGCCAAGGGCAAGAGTGACCCCGAAATGATAAAGGACACGATGCTGGAGACGTTCGGCGACG
ATGGTTTGCGTACGCTAACGATCACCCAACGGCGTGTGGACGAGAAGGAGTACCTTAACTGGAGCGCGCGCTTCAAGGAGGCCAATTCTTCACTAGAAGA
GATTGACAAGCGCAAGAACGGGCTGCCCAACGAGACCGACAAGCTGATGACGGGAATTGAGCGTGATCTGGAGCTGCTGGGTGCGACGGCGATTGAGGAC
AAACTGCAGAGCAATGTGCCCGGCTGCAGTGCCAACCTGATCCGTGCTGGTATGCGCGTATGGGCGACAAGCAGGAGACTGCCATCAACGCCTGTCAACT
CATGGACAATGAATGACATGCAGCAGTTTATCTTCAGCTGCGATCTGTATCCCACAAAGGACACTATCCTTTCGCACCTGACGGATGCGAACGCGCAGGT
CAACGGGGCAGTGGTCGCCACGCTGTGGCGATCGATGGTGAGTGTTTGGAGTTGACACTTGCAGATGACCGGTGCCAGAAGGAATTCTTGTCGCTGGCCA
TGGCATGTGAAGCGGTGGTGTGTTGCCGTGTGTCTCCTATTGGTTCGCACTGCTAACAAGGTGCGACGTTGGCGATTGGAGACGGTGCAAACGATGTGGC
TATGATCCAGCGCGCACACGTTGGTTTCGGTATCTCAGGACAGGAAGGCATGCAGGCTGTGAACTCGTGACTACGCTATCGGCCAGTTCGACTTTTGAAG
AAGTTGCTGCTGCACCATGGCCGCTCGATTCTTGCGGGCTACATGTTATACAAGAATATCGTGACGGTGCTGGCCCAGTACTTCTACACGTTTTGCGCGG
GCTCATCAGGCCAGAAATTCTACGGCGAGTTGGGTTTCCACATTTGCTACACTTCGCTGCCCATCATTGTGCTGGGAGTTTTCGACTACGATGTGCCTTT
AGAAGTCAGCAGGCACTTCCGTGAGCTGTACTTGGTTGGCCCGCGCATGGAGATGTTCAACAACTACACATTCTTCAAGTGGAT