Description :
From Genome Similarity Track
Location :
Scaffold_6:145308- 146604
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003030Protein of unknown function
Pytul_DAOMBR144PYU1_G003029Protein of unknown function

Sequence
1296 bases(100 bases per row)
TCTTGTCCTGTTCGGCGGTGGCGTGGTGCACCTTGAATGGCGACGAGCGGAGTTGAGGAAGCAGGCCCATGGTGTTTCGCTTACGTGAGCTGCTGGCTTT
AGCTTTAGTCGGCTGCTGGGCTCGATGGAATGTTTAGGAATGGACGTTGGGAGGACACGCCGCCGCCTGCCTGTGGTGCGCCAGGGGGCACGCTATGGGT
GAGCGTGAGTCATAGGGATGGAAGCGAGGGAAGCAAAGGCCATCCAATCGGAGCCGCTGATGCGGTCGGCGCGTTTCCCCGCCTCTCGTCCAAACAATCA
CGTGAGACGAGTGACCAGAGTGATGGTCCATCCATCGCCATCCAAACAAAAAGTTTGGAAGCAAGTGAGACGGTCCCGTCTCTTGACACGCACGCAAAAA
GAGACGAGGCTGGCGGAACCCCTTGTCGCGCGTGGCGTACGTCGATCACATTTCGCATGAGCTGATCTCTGCCCCACAGCAAAAGGGTCAATTCCCTCTT
TGTTTAACATATTAAACGCCAACATAGTCAGCATGGGACCTGTTTATAGTTGATATACACGCCTATAAGACTGTGATAGGCATTACGCTAGAGGCTGGGA
AAATCTCATGTAACTGAACTGACGCAATAGAAATGATCGGTGGCCGCTCGCCATTCGAAATTGCCTTGGTATTTGTATGGTGTGATGAATGATAGAAATC
ACACTAGCAATAATGGTGGAAATCACGCCGTGTGTGCGCGTGCACCGTTGTTCGTCTGCAGTTCAACCAGAAGCGCCAGCTGGGCGTGAGGACTTTGTCG
ACGTGTCTTTTTCGGTTGGTTTGGGTCCCTCCGCCAATCGACGGAGCTGCTCGACTCTCGCACATGCACATGAACACGCAGGATTATTTTGGCGCAGTGC
ACGATGGGCATCGACTGCAACTGCACCAGTACACGCGATAAACGTTTAAAATAATTATCGTAGTAGTACGAGTATATTTTAACTTAGTCGCATTTCTTAC
ATAAAAATATTAACAATTGCGAACAACCTTGGCTCTAAATACCTCCATCATCACCGCAAGACGTCGTTCTCGCGGATGCGCTTCATGAGCTGCAGGTCGT
GCTTGCGTCGCTGCCAGCTCCGCCTTGTGAACAGCACAGGCTTGCCGGCCACGACCGTCGGTTTGTCGGTAAACGTGTCGGGGATCTCCACGGGCGGGAT
TGCGACGCGTTTCATGGCCGAGAGACTGAAGCGCATGGTCTTCTCTGGGTGCACTTTGTAGATCTTTTGCTTGAGCGCCTCGCACTCTTCTGGGAG