Description :
From Genome Similarity Track
Location :
Scaffold_2993:1453- 2770
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2993-fgenesh-gene-0.0Pc12g09320 protein

Sequence
1317 bases(100 bases per row)
CGACGTCGCACTCGCCCGACACGGCGGCCGCGCTCTTCTACACGGGCAGCGGCGTGCTCGGCATCTCGGCGGGCTTCCTCTGGACGGCGCAGGGCCAGAT
GATCATGAGCTACGCGACGCCGCAGAACCAGGGCCGGTACATCAGCACCTTCTGGATCATCTTCAACCTCGGCGCGACCTCGGGCGGCCTGCTCACGTGC
ATTCTCAACTGGAAGCGCGACGGCGACGACGCGGCCATGCGCGGCAACGCGTCGCACGCCACGTTCGCCGCCTTCGCCGTGGCCATGACGCTGGGCTCGG
TGCTGGCCATGACGCGCATCGCGTCGCTCGACGACGTCGTCAAGGCCGATGGCTCGCGCGTGGTCGTGGTCGCCGAACCGGCCGACTCGCTCGAGGCGGC
CGAGGGGTCCTCCTCTGCCAGCACGTGGAAGGACGACGCGCGCGCGCTGTTCGCGTACGCCACGTCGAGCCGCGACGTGCTGTGTCTGCTGCCCTTCTTC
GTCTACAGCAACTGGTTCTACACGTACCACGCCTTCTTCAACGTGTCGCTCTTCAACACGCGCACGAGCGGCCTCGCGAGCGCCTTCTACTGGATGGCGC
AGATGGTCGGCGCGCTCGCGCTCGGCCGGTGGCTCGACCACCCGGGGTCGTCGCCCACGCGCACGGCCAGAAACACGCTCGTGATGCTGGCGGTGCTGTG
GAACGCCATGTGGGCCGTGGGCTGGGTCGTCCAGACGTCCAAGCACCTCTCGTACGCGAGTCCGCTGGGCATGGACGTCGTGGACGACACGAAGAGCATG
ATTGGGCCGCTCGTGCTGTACACGATCTACGGCGCGGGTGATGCCGTGGGCCAGGTCTGGATCTACTGGTACCTCAGCTGCGTGTGCGCGAATGGCCGCG
AGCCGCGCATCGCCGGGTTCAACGCGGGCATCTACAAGGCCGTGCAGTCGCTGAGCGCGGCGTTCGCGTGGTGGATCGGGTCGCAAGAGGTCGTTCCTGT
GGGGCAGCTCTGGGTGAACTGGGCGCTGTGCAACGCCGCGGTCGTCGGCGCCGCGCTGTCGCTCTTCCGCAAGTCAGACAAGCAAGACGAGGTGGAGCTC
CCGGACAACGGCAAGTATGTCCCTGTTAGTACTCCCCAGTAAGTGTAAGAAGGACCGTACGACTAATCCCTAGTACAACGTGTAAGACAACTGATAAAAC
ACGCACAAAGACGATTCGCATGGACGTTTCGAGTGTGACGCACATCGTCTCTAGTGGGTGCCCGAGTCTCCTCAGTGCTGCCGCGTCGCGAGACTACAAG
TGACAGAAGTCTGCCTG