Description :
From Genome Similarity Track
Location :
Scaffold_46:145252- 150087
Sequence
4835 bases(100 bases per row)
CTGAGCGTTAAGACTTCCAAAGGGAAATAGGGAGAAAAACTCCTTCTCTGGACTCGAGAGATCGAAATCGTGATGAGCGCCGTTATGCTGCAAACCGAGC
AGCAGAGAGTTGGCCTGGTTATATCAAAACTTGGTGGCAGAGCCAGAGAATGGACTCTGACATGTTATGCGTCTGTAGACGCCGCGTATCTCACGTGGGA
TTCGCTCAAGAGACAGATGTCTTGCGTGTTCGCATCGCCTAGTAAGGCTTATCGAGTGCGTTCACGCTTCTTATCCTCCCGACAAGGGAGAAAGGAGGTA
TTGGACTATGTTCAAGAGTTGAGAACTCTTCTCGCTGCTATTCAATTGGATCCCTTTCCTGAGGAAGTCAGCGTGACCATTATTATGGAAGGTCTTCTTA
CTGGAGTCTCTAGGACGGAAGTTTTTCACGTCCATTCCTCAACCTTTGAGGAGGCGGTGGACATAGCGTTAACGACGGGTTTAAGTTTAAAGCGGCTCGC
TGCGGTACACATGGGCATGCCCAGAACTCGTTTGACAGGGCTTAGCCCATCGATCTCAGTCATGCGGATGATGAAGAAGCCGAGACTCAAGCTGTGAAAC
AGCAATGTAACATCCGTAGGTGTTACACATGCGGGAGCGCAAAACATCTCCTCCATAACAGCCCACTGCGAAGACCGCGACAAAACCAGCCGATCCGTAA
TACCTCTTCGGACCAGAAACTTGGTACGGCGTGGGAAAACATCGACCTTCAGAAGGCGCGGGGCGCCCTACTGAAGACGAATGGGCTCTGTAGAGGCTCT
ATAAGGAAGAGTTGAACAGGTCTTAGCCCCGAACTACATCGTGGAAGTAACCGAGAAGCGTGAATGGAAGACAGGATTGTTGGTTGCCTCGGCAATGGTT
AAGGGCTTTGAGAAGTCGTGGTCAATTTTGATTGACTCTGGGGCATCGGGCAACTACTTCCGACGCCGTTACCTTGAAAGGGGTCAGCAGTATGCTGAGG
CGCTGAAAGCGCACGAATGTGAATTTATCATGGTCCGTCTAGCAATCGGGTCCCGCGTCACCGTCCTAAAGTTCCGTCGAACTTAGGTGTTAAGTTTTTT
AGACTTTGACAGCATTGAACACTGTCTTGTACTAGATTTGGAATCGGTTTATGATCTTATTCTCGGCATGATCTGGCTCGAACGCCACGAGCCATGGATT
GATTAAAAGGTTTAAGACCTTAGGCGCAACTCTTAATACTTCTAGTGAAGCTTTGAGAGTTATGAACCCACTTTCTAGGTAAAAAAGGCGCTATTGGAGC
GATCCACTGAATGAGTCAGTTAGTGTTCTGGGCATCGGAATGTCTGAGTTACTTAACGCTAAAGTCAATGACGATAGTGGGACGGCATGTACTCCTTTGA
GTAACACTCATTTTTATAATGAACCACTGAATGATAATAGCATTGATGATCCAAGATCTATTCATCTAGGGTGTGATCCCTTAAACGTGCGTGGATTGGC
ATGTAAACATTCACAGAGTGAGAGCGGATGTAATAGCATCTCACTGAATGTCGGTAATGAAATTGTTGGCAAGGAGCCCATGCATCAGCCATACTCCCCT
GCTATATGTGCAGTGGCGGATAAGTCGCCGGGTGATGAGTTCGAGTAAAGTAACTCTGCACCGGATGTCGGTAATGACATCAGCTCTTGTATATAGCACG
CTGAGTTTGAAAAACCTAATCACTTTGTGGAACCAGATGTTCCGTCCTCAATCAGAAGCTCAGTCTCTTCGCAGAGAAAGCAGCGATGCCAGATGGAGGC
TGCGAGATCTAAAGCGTCTGTAATGTCGCTTAGTTACTAGCGATCAGCTTTATACACTGGTCGATGGCGTGACAGATCACGTGGATGGTGAAGTCGGTCT
TTTGACCCTCCCATCGTTAACTGCTATGTTAGAGCTAAAAGAAATGTCTGTAGATGATTTCAGTCAGGCCTTGAAGGTAGGCTTATCCGATATGGTGGTC
CTTAGACCCGATACTGAGTTGAACTTCTCGTCTCTATTGGATGAGACGGTCCTTGAAAGTACAAAGGCGGTACTTAGTGCACGTAGTGGATCATCCATTT
TAAACGAATTCTTCAGATCCCTACTACCCTTTGGTTAAAGAATTTTTAAGACGTGGTAAGTCATAATCTACCGTCTGTATTACCTCCCGATAGAGGCGTA
CGTCATGAAATTGACTTGGTCTCTGGAACCAAATACTGCGTCACACGGCAGTAGCCTTTATCAAAATAATAATGTGACGTCGTTGACGAGTTTTTTTTAG
TGCTAAGCACGTGGCGGGAATGGTGCGCGAGAGCAAGTCATCTCATTCCACACCTACCTTTTGTGTTAAAAAGCCTAATGGTAAGTGGCGTATTGTGCAT
GCATATGATAAGCTTAATGCGGCCACTATACCGGCACACACACCAATTCCTAAAAAGGATGTTCTTCAGAAAAACATGGCAGGGGTACAGTCCACTCGAC
CCGGTCGATAAGTATTATCAACTCCTCATACGAGCAGGTGATATCCCGCTCACAGTACTTAAAACACCAAGCGGTATGCTTGGGATTGGCTGGTTATTCC
CCAGGGGCTTTCCAATGCCCCGGCTACGTTAAATCGTCTAGTGACGCAACTTTTCCGCCCTCACCATGCTTCTGCATAAACGTATTTGGATGATATATTT
GTTCATAGCCGTGCAGAACAGGGTCGGTCAGACGTGGATGACCCATCGATCACGTACGAGATGTGCTTGAGTGCATGCGCACAAATAAGCTGTACGCTAA
TTTGTCAAAATGCATCTTTGGTGTGGACGAGATTCCATTTTTGGGGTGTTTCATTGGGAAGCGAGTCCTTCGAGCGGATCCCGCAAAGGTGGAGACAAAA
GTGAATTGGCCAGTCCTAAGAACTAAAAGGATCTGCGCAAGTGGATTGGCCTTGCCAATTACTTACATAAGTATAGCGACAATTACGCTGATATGGCTTG
GCCATTGTCCAGTCTCCTTAAAAAGGATGTATGTGGTGCTGGACTAACACCGAAGATGAGGCCTTTAGATCTGTAAAGGAGGGTCTCCTACATGCCCAAA
TTTTAACTTTGCCAGATCCTGATCTACCCTTCAGTGCCGTCTGTGACCATTTGATTTTTCCATTGGATGACCTCTGTTACAAACTTATGTTGAGGGACGC
GAGCTTCCCATCGCTTTTACATCTCTCCAGCTTAAAGATGTCGAAAAGAACTATCCAGTATATGACAAGGGTATACTTGCTATGAAATATGCTCCAGTCA
AATCCAGAGTTCATCTGCTTGGCTTTAAGCCTTTCGTGATCTATACCAATCATGCGTCTTTACGCACTGCGAACCAAACGCCTCACCTCTCGCAGACGAT
GGTCCGTTGGCTTTCATTCTTTGCAGAATATAACTTCGAGGTAAATTATAAACCTGGAAAGAAAAATACGCTGGCTGATGCGCTGTCACGCCGGCCTGAT
TATAATCTCGCTCATGTTGCGATTCTGTCCTCATCAGTTACTGACTTGATCCGTGCGTCCTATGCCAAGGATGAACAATGTGTATCTTTGCTACGAGATC
TTGGAAGTGATGAGTTTAAGGACTCGGACATTAAATTGTCGGCAAGTTCGCGTGCTAGGCTGCATCGATATTCTATCGATCACGGCTTGATGTGCTATTG
CACGGATGCTGCGGATACCCCGCACATCGTTGTTTCTCATGGTGAAGAAGTGAACTAGTGAATTATCTATGAGGTCCATGACACAGTGATTAGCGGTCAT
CTCGGTCTTGAGAAGACCTATGGCTAAGTTAGCCAGAGTCATCGGTGGACCAAACTCTAGTAATGGGTAAGTACTTATGTGCGCACATGTGATACGTCCT
AACGGGTCGAATCCTTGGCACATGCGGCCACGCCGCTGGCTAGCTTGCCCGCACCTTCTAGGTGTTGGGAGTCCATCAGCATAGACTTTGTATTTGGCCT
ACCAAAATATTCGGACGGCAACACACCTATTGTGTTTTTTGCGGACCGTTTGAGCAATATGGCTCACTTATTGGCTGAGCTGGACTCCAGGTATGGTGAA
GGGACATCTTTGCTGTTCATTGGACAACACGGTCTACCACTGGCAATTGGCTCGGACAGAGATCCTCGTTTCACGCCTAGCACCGTGAAACGAGGCACCA
GATTATACATGTCTATAGCGGATCATCCGCAGACCAATGGTCAGACTGAGCGCGTTAATTGCGTCTTCGAAGGTATTCTACGCAGTGTGAGCGCTGATAC
GCCTCGTTGTGGAAGCTCAGTGCTCTTCATTGTTGAGTTCACCATGAACAATGCCGTCCATGCCTCGACCGGCTATACTCTGTTCTACGTGAATGGTCCC
AACCCCCCGCGTTCCGTTGACGCTACCACTACGTCGTTCAGCACTTTGATGGGGGATAGGTGGCTGTTCGGCTTGATAAAGACAGCCCTGCTACTGTTCA
AAAACAGGTTAATACGCTCCTTAAAACGAGATTGAATGTCTTAAGACATGTTCGTGACGAAATGGCTGATAGCCAAGACAAACAGAAGGATCAAGCGAAT
GCTAAAGGTAGAAGCTGTATCAAACGTTATAAGGTCGGTGACCAAGTCTTACTAAACGCAAAGAATCTACCTACCAATGTAGCGTCTGTTGTGCTTGAGA
CGAATCTGCGTCCTCGCTCTATAGGACCATTTACGATCGTGGCCAAGAAGAGCCTTGCGTATAAGCTTATCTTGCCGCGAAATCTGCGTACACACCCCGT
GTTTACGTTGGCCTCTTTAAGCCGTATCGGGATCC