Description :
From Genome Similarity Track
Location :
Scaffold_91:145215- 147463
Sequence
2248 bases(100 bases per row)
TTACCTCCAGATAGGGCTGTCCGTCATGAAAATGACTGGGTTCCTGAGACTAAATACTATGTCACACGACAGTGGCCCTTGCCAAAAAAAACTAGCGATG
TCATTGATGACTTCTTCCGTACCAAAACCGAGGAGGAAATGGTACGTGAGAGTAATTCTCCACTTTCGACACCGGCATTCTGTGTCAAAAAGCTGAACGG
CAAGTGGAGTATTGTGCATGCTTATAAGAGTCTTAATGTGACCACTATTCTGGCACAGACACCTATTCCTCGAAAAGATGTTCTGCAAAACAATATGGTT
GGTTGTACTATGTATAGCGCACTCGGCTTAGTCGATGGATATTACCAATTGCTCATGCGATCGAGTGATATTTTGCTGACGGCCGTGAGCACTCCGAGTG
GTATGCTATGAGGTTAACTGGTGGTGCTCAAGGTCTACCTAACGCCCCGGCTACATTTAATTGTCTGGCGACACAACTTTGCGCCCACACTGGGATTACG
CACAGACGTACTTTGATGACATTTTTATCCATAGTAGTGCCGAACAAGGTCGATCGGATGTTAATAGACACATCGATCATCTGCGAGCCGTGCTCGAGTG
CATGCGCACGAATAAATTGGACGCGTCTAAATGCATTTTTGGTGCAGAGGAGATACCTTTTCTAAAATGTTTCATTGGTAAGCGTGGCCTTAGAGCGGAT
CTTGCTAAGCTCAAGGCTATAGTGGACTGGCCGATTCTTAAGAATCAAACGGGCTTGCGTAAGTGGCTTGGCCTTACCAATTACTTACACAAATACAGTA
AAAATTACGATCATATGGCTCGGCCATCAACTGATTCCCTTAAGAAAGACACAGATTGGCGCTGGGACAACACTCATGCTAACGCATTCTGAGCAGCAAA
GGAAAGTCTCCTCCATGCTCTCATTTTGAAGTTGTCAATCCTGGGTACCCTTTCAGTGTCGTCTGCGACGCATCCGACTTAGCCATACGCAACGCCCCGC
TGCAAGCAGATGCTGAAGGCCTCGAGCGAGTTGTCGCCTCCGAATCTCGTCAGCTTAAATCTGCTGAAAAGAACTATCCAGTTCATGAAAAAGAGCTACT
TGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACACCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAG
TCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTCTAATTCTTTGCCGACTATAACTTTGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTG
ATGCGCTATCGCGCCGACCTGAATATGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTGAATCCGTGCGACTTATGCCAAGGATGAACA
ATGTGTAGCTTTGCTACGTGTCCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACATTTACGTGCGAGGCTAAATCGATATTCTATC
GATAATGGCCTGTTGTGCTATCGCACAGATATTAAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCAC
ATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTAAGTGAGCCAGGCTTATTGGTGGCCCGAACTATACAAAATGGGTGAGCACCT
ATGTGTGTACGTGTGAAACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTGTACCAACTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGT
TTGGCCTACCAAAAGATTCGGAAGGCAAAACTGGTATTGTGGTCTTTGTTGACTGGTTGAGCAAGATGACTCATCTAGCGGCAGTGCCGGACTCTATTGA
TGCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGCAAG
TTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACGGAGCGTGTTAATCGCGTCA
TTAATGACTTTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCTCCATGGTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTC
TACAGGCTATACTCCGTTTTATGTAAACGGTCTCACCCACCCTCGCGT