Description :
From Genome Similarity Track
Location :
Scaffold_400:1452- 5824
Sequence
4372 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACAAGACAAGTTTGATGATGGT
TCCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCCCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGCTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGCCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGAGGGTCTGCCGAGTGTTC
GTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCTCGTAGCTCCTTTTCTACAGCCTGATACTCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCTTCAGACTGCTTGCCGAGCCCTTGTTTGAGTGATGACGACATTG
CCCGCAACGTTGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTCT
GGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTA
ATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
AAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAATTCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCTGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTTTGCAGGACCTCTTGAAT
CATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GTTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACCGGGTCAACATCGTCCGCATCGAGAAATGCCGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCCTGGCCGATTGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTCTTCTTGAGCTTTTGAGACATCCTCCGAGTGT
TCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCACACTCTGGTGAGTTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTTGTGACGAAACATCTACCGAGTCTTCATCCGG
CTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTG
GCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGACGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTA
GCAAAGTTTCCTTCCTGCATGCGATCACCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCA
GCCTTGACACCGTTTATCATACCTGTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGC
TCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGGTGTAATTACGGGAAAGCCT
GGCGTACAGCAACGCGGGGTCCATTCGAACAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCCTCCAGGTCAACGAAGCTCGTGATG
CTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAATGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTC
CGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAG
CAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCA
TGTTCTTGCATTAGTGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTG
AAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTA
GACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACTGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATAGCC
GCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGC
TGATCCGACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCG
TCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCT
ACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAATTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCT
CCGAGTATTCAAACCAACCTCTTTTAGGTTGAACGAACCCCCAAAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGG
CATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACAAACGCCGATACTTTACGTGCTCACAAGATCATCATGACCGCCCAGAAGCCGCTTGCTGCATCC
AGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGT
AATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAA
TAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCAT
ACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCG
ACATCTCAGGATCAGCAACATTAGGCGCAGTGTAGTCAATTGTCGTGTTGATCTCTTCGGTCAGGTCCGGCA