Description :
From Genome Similarity Track
Location :
Scaffold_2637:1452- 2850
Sequence
1398 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTTGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCAGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTTGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCTAGCA
CCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTC
CCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGGTCCGGCGGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGGAAGATGGGGCCACT
TCAAGCGCCGACTGTCTCGGCGGGAAGACTCCCGCAGACGGGTCCTTTCCCAAGCCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGGATCCCGGGGAGC
AGGGGGAACCGCAGGGAAACAGTAGGGGCGGGGCGGCCTACTGGGGAGGAACTAAGTCTTCCGTGATGGGGTGCGCGGGTGGGGCGCGTACCACGGGGGA
CTTAGGCCCTGAGAGTCTTTCGCACTTCTCGAATTCGGCGAGATGCAGGAGGCGGGGTTGGCTGCGTAGTTACACGGGATTGTGTAGCCGGGGGGTAC