Description :
From Genome Similarity Track
Location :
Scaffold_141:14518- 16359
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.8Tyrosine aminotransferase

Sequence
1841 bases(100 bases per row)
TGATGGCGCTTGCAGAAGCTCGCGAGGCGGGCGTACGCGTCGCTCAGCACTTCGTGCGGCGCAGCGAACACGATGCGGAAGTAGTTGGTCATGCCAAAGC
ACTGGCCAGGCAGCACGAACACGGACTCTTCGTCCAGCAGCTTCTGCGTGAAGTCAAAGTCGTCCTTGATGCCCGTGAGGATACTTGTGTCCACGCCGAC
CATCACGTACATGGCGCCCTGCGGGACGACCACTTTCAGCCCCGGGATCTTGCTCAGTGCGTTGGTCGTGAACTTAGAGTTCTTCTCCAACGTGCTAAAG
TAGTGCGCCTTGAACTCTGCAAGCGAGTCGGCTTCCGCGCTTCCGGGGATTGGTGTGAGCAGGTCTGGGATGGCACTCTGATAAATCACAAGAGTAGCAA
GAAGGCAAGTCCGTTAGTTCCGTACCAGTCTGACAGATCAACTCGGCAATAGCAAGAGCATAGCATACCTGAACCAACGAGTTGGCGCCGAGAATAAGCT
GCGAGAGCTTGAAGTAGGCCGTGCGCACGTCCTTGAGCACGTTGTTGCGGTCGTTGACCAAGACCCAGCCCACACGCCATCCAGGGATCAGGTAGTGCTT
TGCCAAACCGCTGACAGCAATCACAGGAACGGTCTTCGTCAGCGCAGCCAGAGGGTAGAAGAGGTTCGCGCCGAAGGTCATGTCGCCGTAGATCTCGTCC
TGTGGAAAGAATTGTCGTACAAATCAAGTGAGTTTTAGATGATATCTCAGCCGATGATTCCAGCTGCAGCACTTACGGAGATGATTGGGAGCTTGTTGAA
CTCCGCGAGCGCGAGGATCTTCTCCAAGTGCGGCTTCGAGTAGACGCTCCCGCACGGGTTCGACGGGTTGTTCACGAGGATCGCCTTGGTGTTCTCGTCG
ATCAGCGACTGCATGTGCTCCAAATCAGCCTCCCAGTTGTTCTCAGGCTACAGAGCAACACACAAGTAGCTCGATGAGTCTTTGCTGTCACGAGTACAAG
TACAAGTTTTCCGGGGGAGTTTACAACGTACGTCCAGGTTGTAGAATTTGCATTCAATCTTGTGGGTCTCGCAGATCACTTGGTACAGCGGGAAGCCTGG
CTTTGGAAGGAGAATGTTGTCGCCAGGGTTCAGGAGACCCGTCAGCGCGATGTCGAGCGCGCCAGAACCGCCGCTAGCGATAATTACATCCTAACAAAAC
ATGCACAGAAAGTATAGTTTCGCCAGTGAACATCCGACCCTACTCTCTTCAGCAGCGACTCAGTTGGTATTGTCGTACCTCTTTCGTCAGTGGCGCACTC
TTGCTTCCGTACTTCTTCGCGATGGCTTCACGGGCTTCTTCCGTACCGGCCGAGTGGATGTAGCCATTGTGCTTCATGGAGCTGCAGGTTGCAAACGAAG
ATGACCATGAAGTCAGTATCATCCCTTAGTGAACTAACACGGCATCTGACATGGTGAACATTATTGCTGCGCATACATACCGGACATTGCGCACGATCGA
CTCCACAAGCACGTCCGGGCACTTGAAGTTGCCAAACACGGTCGGGTCACCTGGTGTCAATATTAATAGATAGAGAAAGAGAGTAGTCAAGTGAGTCAGT
CAGTCAGTCCATCCATCAATCAGGCATCCATCTTTCGTCATGATGGTGAGGCAAAGACATGCGCGCGTATTTCGTGCGGCTTGTCTGTCCAAGCAGCCAT
CTCTATTGCGCAATAACCATGCATTTGCATGCGTTGCGTACCGAGCGAGAGCGGGATGAGTGTCTTGTCGGTGTTCTCGGGCTTCTTGATGTTGTCCACG
ATCTTGCGAATGGGGTTGGCGCAGAGCTGCGAGAGCTCGGA