Description :
From Genome Similarity Track
Location :
Scaffold_65:145146- 147158
Transcript NameFunction/comments
g1751.t1ETI32585.1 hypothetical protein F443_20622 [Phytophthora parasitica P1569
g1752.t1XP_008897903.1 hypothetical protein PPTG_05916 [Phytophthora parasitica INRA-310
g1753.t1XP_009522113.1 WD-40 domain-containing protein [Phytophthora sojae

Sequence
2012 bases(100 bases per row)
CGAAGAGCTGCGACAGATCGAGCGCAGCAGCGCCGTCTTCCCCACCCCGGAGTCCCCCACTACCAGCACGCGAACGCTCGGCGTCTCCATTTCAACTATC
AATTGTGCAAGGTATACAGACTGTTTAGTCACCAATTAGAGATGAGAGGTACCCTGTTTACAACGATAGTGAGCTGATAATAATCCCGCATTTGCTGATA
CTCACCATGGCGGAGGAGTGGGCGTACGAGGAAGCTTCGGACGAGGAGAAGCTGCAGATCGCGCAGCGGTTCCTGCTGGCCAGCCCCCCGGGGCAGATCC
ACGAGGTGCTGCGCGACGTGGCCAAGCTGGTGCCGGCGCGTGTGCTGCCGGACGCGGCACTGCGAGGCGCGCTGCACGCGTACAATGTCAAGAATTTCCT
GCCCGTGGACGTGCCGGACGCGGACTACAAGGTGCGTATACAAGATGACCCCCGCATCACTGGATAGAGGGCACTCTGGTCTTGAATATGAGCTCCCGGA
TCAAGTCGTGTGGGTTCTGACGATCGGGATATGACACTTTATCGATTTTGACAGATCCTCATCTGCGAGGAAGGAGAAGTGGACGCCGCCCACTACGTGG
ACCCCATCGGCAACCGCGTGCTGGGCTTCGACCATATCAAGCAGCAGATTGTGGCCGAAGATGTAGCCGAGATCCCCGAGGCCAGAGTCTCGGAGTTCGA
GAAGGAGCGGTGAGGGACAGAGAGATTTGTATAGTTTTGTTACAGCTGCTGACGGATGATGCTGTTCTTTTGCAGACAGGAGGTGCAGAAGACGCTGCAG
TCGTACCTGCAGTTTGAGTACATGCACGGGTGAGGAGATACATATTTGTATAGGAGGTGGGGTTGTCGGCGTGTTGCTGAATTGTGTTGTTTGCTGTTGG
TGTAAAGAGGGACAGCTGGAGTGTACGTGGTGGGCACGAAGATCGTGGTGAACCTCTGCACGGAACGCATCAACCTGCGCAACTTCTGGGGCGGTCGCTG
GAAGTCGCGATGGGAGGTGGACCTCACGGAGAACCCGGCGAAGGTCAAGGGCTCCATCCAGCTGCACGTGCACTACTTTGAGAACGGCAACCTGCAGCTG
CAGAGCTCCAAGGAGGTGGAGGAAGAGGTGGCGATCCAGCGCCCCAACGGACTGGGGGACGCTATTCTACGCGTCATGAAGGAGGCTGAGGATGACCTGC
AGACCAACCTTGAAGATATGTACATCAACATGTCGGAGGAGACCTTCAAGGAGATGCGTCGTGTTATGCCTGGTACGTGTGTCGTTTGTGTTGAGCAACT
AGCCGCTGAGTGCTTGAGCTCACCTTGGTTGACGTTGTGTGCAGTGACCCAAACGAAGATGGAATGGAGTCTGCACGCGCACCGTACGGCCAAAGACCTT
GGCCGCAAGTAAGAAAAGAGAATGGTGTACAGCTGCGCCGAAAGCTGACGCAGTCAAACAAGTGCAAACACTGAAATGGAAACAATTGTGCAACATGGCA
CGTGGTACGGCTGGCTTAGTACGCTGAGTTTTTAACGGGGGTGGTATGTTTTAGTTTCTAGCTACTGAGCTCAAGTGTCTCCAGCAACTCGCTCTCACCG
GTTTGAAAGTTGGCCAGCTGCCACGAAAGTTTCCAAATGTGCACGACTCCATCGGCGTCACCCGCCGCTAGGAAGTTGCGTTGTCGTGGATTGAAGTCGA
GGGTAAACATTGGCGCAGTTGCTGTCTTGGAGGTTGCTGTCGCAGTGCTCTTCGCTGCGCTTCCGTTCGACGACGAGGAGCGGACTAATGTTGAAGCAGA
CCCAGTAGCTGGGTCTTTGCCACTGAGAACCAACACGGGGCTTACGCGATCAACTTTCAGGTCGAACACGTAGACGTTGCCATCTTCGCTGGCTGCAGCA
AAAACCATGGGGCGTGTACGGGACCACTCGGCAGCATAGAGATAGGCTGCTGACGGTGCTACCTCAAGCGAGAGCAGCAACTCACGCTGCAGTGTTGAGT
ACAAGCGCGTAG