Description :
From Genome Similarity Track
Location :
Scaffold_606:14512- 16437
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_606-abinit-gene-0.25Pantothenate kinase

Sequence
1925 bases(100 bases per row)
GAGCGCGATGGGGGACCGCGCTCTGATCACCAGCGGCTTCTTCCTCTTCTCCGGCTCCGTGCTCATGCTCTGCGTGCGTCGCAAGCGCGACCGTCATCGC
CTCTGGCGCCAGCGCGTCACGTTCAAGAAGATCTCGAAAAAGTACGTGTGTGCTCTCTCTCTCTTTGTTTTAGGCTGTGTGTATGTGTGTGTGCATGCGG
CAGAGAAGTGATACGCATGATATATATGTGGGGCGGTACTATCGTTGTATCACTATTGCTGACATGTGTGTGCTGCTGCTGCTGCTTCGCTTAGCTCGGA
TCTCGGTCACTGCTTCGGACTTGATATCGGTACGTTCCTTCCCCATACTTTCATACTCTCTATTCACGCTTGACTGGCATGCTGACATGCGACTTGTGTG
CATCTGCGTATCTATGGACCATCAGGGGGCACGCTGGCAAAGATCGTGTATTTCGAGAAGCGCGAGTCCTCGTCGTCGTCGTCCTCGTCGGGGACATCGT
CGTCGTCATCTTCGGTGTCGGACAACCGCAAGCGACCGCGCTCGTCATCGCATGTCATTGCTGCAGGGGAGATGACCAAGTTCCTCATGGAGAACGAGAG
CTTTGGCGAGACGGGCGTCCAGGATGTCCGCCTGCGCGTACACTCGAAACCTTTGCAAGGTGTACGTACAGCTAGCGTGTTTTTGCGATGGAAAGGAAAG
CTGGCAAATTGGTACTATTGGTGATGCTTACTTTCTTTGATGTTACCGTGCTACAGGTGTTCCACTTTATCCGATTCGAAACCAAGCAAACAAAAGAAGC
GATCCAGTTTATCGCGACCAAAGGGCTTCACCAGTCGCTGCGCTCGCTCCCGTGTACTGGTGGCGGCGCGCACAAGGTACGCAGAAGTAGTAGAAGAGCA
TTTTGTGTAATTTCGTGTGGCAAGTTTCTATCGAGTACTAACGAGTTTTACTTTTTGTCTACTGCACAGTATGGTCCGATCTTTAACGAAATGGTGGGGA
TCGAGCTGGAGAAATACGACGAGATCGAGTGCACGATCCTGGGACTGAACTTCCTTCTCACGACGCTCTCGGACGAAGTCTATACGTTTGAGGTAATTAT
CACTGACCGTCGTTGAGATATCTTTTGTAGACACTCGGAGAGTGTTATCCTCACGGAGAGTGCTGGAATGTTTTTTCAATAGGATGTTGACTTCAAATCC
CTCGCTGCGTCGCGAGTGAAAGTGATCCAGAACGAGGTGGACGAAGACATCTTCCCATACTTGGTGAGCTCTTCGTGCATTCTGTCAGAGTTCTGTGGTT
CAGACTGGTGGCTAACAGATTTTGTGTCGAAATGGAACCAGCTTGTGAGCATCGGTTCGGGTGTGAGTGTGCTGTACGTCAAAGGTCCAGGCGAGTTTGA
GCGTGTGAGCGGATCTAGCATCGGCGGAGGCACTTACTGGGGGCTCTGTCGTCTGCTCACCAAGTGCAGCTCCTACGACGAAGCGCTGGACCTAAGTGTT
GAAGGCTCTAACTACAATGTGGACATGAGCGTCGGTGACATCTACGGTGGAGCGTACGACAAGTTCAACCTCCCAGCAACCACTGTCGCGAGCAGCTTTG
GGAAAATGATCTCGACATCTCGCGACAGCGTGAGCGACGCGGACCTGGCGCGGTCGCTGCTAGTGATGATCACGCAGAACATCGGCCAGATCGCGTTCCT
CAACTCGTGTTTGTACAAGACGAAGCGCATTTTCTTTGTCGGGAACTTTCTGCGCCACAACAAGATCTCCTCCCGCACGCTCGCGTACGCGATCAACTTT
TGGTCGAAAGGCAGCATGGAGGCGCGCTTCTGCAAGCACGAAGGATACTTGGGGGCGCTAGGAGCTTTCCTGCGCAACGCGGAGGTCACGAACGTCCACG
GCGAGGCGTTTGCGTCGGCCGCTCG