Description :
From Genome Similarity Track
Location :
Scaffold_41:14511- 15593
Sequence
1082 bases(100 bases per row)
GTGCACTGATGTAACACGATGATGAGGGCAAGAAAAGAGTTGTATCGTATCAGTCACGACAACTCAGGCCCGCGAAAGGAACTATCCAGTCCACGACAAG
GAACTATTGGCCATGAAATATGCATTGGCAAAGTTTCGAGTCTATTTGCTCGGTGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAG
CTGTAAAGACGCCTCACCTATCGCAAAGAATGGCAAGATGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTACACTACAAGCCAGGCAAGACGAACAT
TCTTGCCGATGCACTGTCAAGACGTCCGGATTATGATCCGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACGATT
GCTACGGGAGTGACAAGCACAATCCAAAAAGAAATTACTGAGGGCTACAAGCAAGACGAAGCATGCCAAGAACTGATCAAGTATTTCAAGAATCCCTCAG
ACAAGGCACTCCAGAACCTCCCATCAAGAGCAAGATCGCGTGTTCACCGTTACAGCATGCACAATGAGCTGTTGTATTATGCGGTTGACGAAGGGGATCC
AGCGAGGATCGTTGTCCCCAACGATGAAGATCTGCGTCATCGACTCTTGTACGAGTATCATGACAGTCCTTCGGGTGGCCATCTCGGACGTGAGAAAACG
TTTCTCAGTTTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAAGTATGTGAGAACTTGCGAGATCTGCCAGCGTGTGAAGCCCTTTG
GCTCCACGCAAGCCCCACTTCGTTCATTGGTTGTCCCATCGGACAATTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCTCGTGACAAACACGG
ACGCAATGGCATCCTTGTGTTTGTGGACCGATTCAGCAAGATGGTCCATCTTGCACCGGTTTCGGACAAGATCTCAGCCGAAATGACGGCCAAGGTCTTT
GTAGGCGTTGTTTTCCGTCTACATGGCCTACCAGTCGAGATCGTGTCTGACCGTGACACTCGTTTCACATCCAAGTTTTGGC