Description :
From Genome Similarity Track
Location :
Scaffold_15:14511- 15527
Transcript NameFunction/comments
Phymu_g1055conserved hypothetical protein

Sequence
1016 bases(100 bases per row)
GCGAGTTCTTACATTGTTCGTTCACGATGGCCACCAGCaaacacagcagcaaatATGGCTACACGCTGAATTTCGACTGGAAGCACCCGTGGCCCCGCGC
GCCGACGCCCAAGAACGAGGAGGCGCGGCttgaggagctggccaagtaCCGCATTTTGGACTCGGAGCCCGACGAGAAGTTCGACAAGCTCTGCCGCATC
GCGTGCAAGGAGATGAAGTGCCCCATCGCGGCCGTGAGCTTCATtgacaagcagaagcagtggTTCAAGGCCAACAGCGGCCTCACGCAGCGCCAGATCC
CGCGCGACGTGGCGCTCTGCGCGCACACCATCATGCACGCCAAGCGCGCGCTCGTGGTGGAGGACAcgtcgctggacgagcgcttccagcaCAACCCGCT
CGTCACACGCGCCTCGGCTGTGCGCTTCTACGCCGGTGTACCCATCACGACGCCCAACGGCTTCTGCATCggctccgtcttcgtcttcgatgTCAAGGGC
CACCACAACGTAGACGCCAAGATCCTGCACAAGATTGCAGCCAAGGTGCTGAAATACATGGACGAGCGGCTTAAGAACATGGCGGCGGCTAATGGCGGCG
CGCTACCAGAGCCCGCGGCGCCCACGTCTACCGGTTCCAGTTCGTCCCGGTCCAACCCCAACACCACAACTCCGAAGCGGAAAACGGTGTCCCCACCCAC
GTCAGGCAACACGGAGCAACCCGCAGGAGAGACCGCTCTTagggagcagcagcctcccCCGGCGCCGGTAAAACCCGAGCCTGTGGCAGAACCTATGCCG
AATCCGGATGCTACGAGTGCCGAAAGCGGCGCTATTGTCCAGGCCGCACAGGCCGCAGCAGCTACTAGTACGGCCATCGAGGCGCAAGGACAGGGACAGG
GAGGACTGGGTAACATGGGCTCAATGCTCATGAACCTGCTGGCGCGcacgacggagacgcagcagcagctcgcagctcAGCAGGGGGTCATGTTCGAGAC
GCTGGGCGAACACTCG