Description :
From Genome Similarity Track
Location :
Scaffold_234:14510- 16229
Sequence
1719 bases(100 bases per row)
GGTTATGCTGTTTATGCTATCGTGATTGCATAGTATATATGTTTTGCCAATGTTATCGCGCTCTACGATGGTTCCGTGTCCGCGGTGTGCAATCTTGGTC
TCCAGAAGCGTTTCCCCGCGATTTTGTGGCTGGTCGGCCGTCCGGGTAAACGTGTTTTAATGAAGTATCGTTCTCAGTGGTCCGGCGATCTCATGCTCTA
CTGTGCTATCGTGCTCAGTGGCTCGGTGATTTCCCGTGGCTGCTTGCTCTTCCATGTTTTAGTGGCTGTCCCATCGTTCATGCTATCGTGCAATCGCTTG
GTGTCGCGGCTGGTCTGTCATCCAAGCTCTCGTTATCTACAGTAGTATCGCGATCCCCAGTGAGATCCGTTTTTACCCTGGTATCGTGCTCCAATACTCG
GTGATTTCTCGTTTATGGTCTCCCGCGGCTTTATGCCTGGTCCGTCGACCGTACTCCGTGCTCTACCGTGGTGCTATCGGAGAATTGCTGTTGGTGCACT
CTTACCGCTACGTGTTCTACCGTGGCTTCGAGCGTGCGTGCTCTTTCGTAGCCCGTGCTTTTCAGCATGCTGAGGTGTCTATGGATTTAGTTCCCTTCTG
TGGCCCGTACGCTCCCGTCATATTCTTGTCGTTCTGTCCTGTTCATGGCTGCGTGCACTTCCATATTTCACGCTACGTAAAACACTTCGTGGTTTGCATC
GCCTAAGGCTTCTATCTTTCGTGCTTCGTGTTGATCTTCTATCCCATCGTCTACATAGGGTGGGTCGATGTTCCTTCGGGCTTCGTGCTCTTGCTTAGTC
ACGTGCATCCGCGCTACCTTAAACACAATAGCTGTTCCCATTTTTTATGTACGCTACATATATTGTTGGAAAGTTTGCAGAATATCTGAAGGTCGCACAC
TACGCGCGCAAATACAAAGGAAGATGACACTTTTTCCCGGAGGCAGTGTGGGGTGCAGGGGTGTAAGCCACAATAGTCATATTTTAAAGCTTTCACATTA
TTATTAATAGTAATACAATTGCTATTTATTATTAAAGGCTGATATAATTATTCGTGTACTACTACTACAAATGACTGCAAGCAAAAATATGAAATGGCTT
GATAATCGTACTATAAAAATAATATTGTAGGTTAAATTAGTACAGCAGTACTGTAACGGGGTTACATGGTGTGGAGCACACAGGGGTACGAAGTACCCGG
AGAGTTAACAAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTATCTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTCAATAGAACACCAACTATCAGGATGAAGGCGAAGATGGAGACA
CTTGATGTGATGTTGTTTGCCTGCTTCGACTGGCCACTCGATGTATTTTTGTTGGGTTGAGCTACATCGTTATGGCTGACAGCAGTGACTGCAGTATTGT
ACTTGTTTGGCCGCTTACGCATTGCTTCGTCGTGGCTGATCCGGTAGTGACGTTTCAGAAAGATATCTTTCGTATCCTTTTGTGCGTACGCTATTTTTTT
TTTAAATACCGTACTCCTATTTGTGATTCAGCCATGTTTTCGAAAAAGGTTAGGTGGCTAAAGCATGTACTTTTATCACATGATTCTAACGTTACGACAT
AAATTACGAGGAGCGTGAA