Description :
From Genome Similarity Track
Location :
Scaffold_1423:1451- 3321
Transcript NameFunction/comments
Phyta_totarag12945hypothetical protein

Sequence
1870 bases(100 bases per row)
TGGCTTGCAAGGCGAGTTTCTGCCACTCCAGGTAGCACCGATACGAACCCCGGGCTCCAGGTAACGGGGCTAGCATGCCAATCCTCTCGTCGCCTTGGAG
GATAAGCGTCTTGTCGCCAATGTTCATGACTTGATGATACTATGACCTGCCAGGACCTTGTTTTCTCCCAGCGTCCACCAACGGTTTCTCATTGTCTGAT
GTCCGTAGgcgctgcggcagctcggcGGACTTCCCGACCTCAATCTGCGTATGCTGACCAAGCTTCAAAGCCCGTAACATGTCATTGAAGAGTCGACCTG
ACCTCTTGGGGCAAGCACAAGGATCCATCGCCAAGCCCCAGCCGGAGCCCAGCCGGaaccatgaagtccatgccGAGGGTCGCGTGCTGTCCAGCTAAGG
AGCCGACCCAAGTGTCGAAGTAATATACCAAAGATCCAAACCAAGGAGAGCTTGACTCTTGCTTTTCCATTCGTCATGTACACGTTCTCACCGATGCCGC
CACACTCTTGACTCTGACTGGTATCAATACAGCATCATACCTTACGAGCAAAGGCGGTGATCACAATGGACACCTCAGACCCGGAGTCTAAGAGTAAGAC
AGCCTTCACATTGTTGATCATGCCTGTTGCCTTGGCTTGTTTGAACCATTTCCTGAAGCGTAATATTTACAGAAGCCTCGAGACGCTCCGGGCAGGAGAG
CAAGGTCCATCCTGACATCTGATCGCTGGAACTCATCGACTTGACGAAGTTTTGAAATCGCTGGAGTACGTTGTTGATGCAGTTCACTATATTACCGAAT
ATATCCGCTTGCTTGTTGCTAACAGGATCCTTCGATCTTTTTTCCACAAATGCATAGATTAATGATGTAGAACTATCGTGACGTACCGGATTCAACCCCG
GCTAGCGTTCTAGTTTAACATCTTCTCAACAGATTCAGGTAACATACCCGCATGCTTGTTCGGGTTGTACCACTGACGGATCATGTTGTAGAACTCTTCC
ATTGGGTACTTGCCCACGTAATGAAGCTCACCACATTCGTGACAGACAAGCAGACAGAGATCTGACGGGTGTCCTTGTTTTCCATACATCGGATAGGTCA
GgtgtctccagcagccaTGATCCGTATGGCGGACGGACCCGCAGTGCGAGCAGCGAGTGTGCCCCATGCTATCATGCCCGGTCGGGAGTCGGCGCccctg
ggggggggggggggggggctgatCCGATCCGGCTGGCAGCCATCATGGTTCCTCGCTTCGTCTACAGGTGTCTGTTCAAgttcggcggcggcagcgatgT
ACACTTGACGCAGATCACCGTCGGTTCCTTCTGGTCCAAGGTCTTAAGATTCAGATCCTGAGTTGGGATTCAGGATCAAGATTGCCCGTACAGCTCGGGC
AGGCGTCGCTGGCTGAGCAGGTGCTGCCATCTTCTATCGGTACTTGTTTCTTCTGCCGGGTCCTAGCTCTCTCTTGCGTGCAGGGCATCCTCAAGTTTGT
CGGCGTCTTCGAGGCGTAACAGCGTGAGTGGGTCGGCCAGATCCTGGTCGTCCAAGGTAGCAATGAAGTGATCCACGTGGTCACGTCGATCCTTCAACTC
GCCATCCTTGACCTTCAAGGGCGCTCGCATCCCAGCCACGTTCAAGCGGTGGAGGTACTCAAGTGGTGACTCATCCGCGTGCATGCATGCGTGATAATAC
TGCCATGCGACCGAAACCCCAAGTCCGCAGTACTGCGTCCGGAAGCTACGCAGCAAGTCGCTCCACTTGTTGTGTACAGTGCGACCCAGTTGGCGATACC
AGTTCTTCGCGGATCCTGTGAGAAGATTGGCGGAAGTCAGACACTTCTCTTCGTCCTAGGTTTGGTCGCG