Description :
From Genome Similarity Track
Location :
Scaffold_1613:1451- 2942
Transcript NameFunction/comments
Phymu_g13475hypothetical protein PHYSODRAFT_511466

Sequence
1491 bases(100 bases per row)
NGATAGAGGTAGCCTAACGGAGTCTCCTCAGATCGCTTGCGTGCATGGTAGTATTGCCACGCTACGGATATTTCCAAGCCACAGTATTGCGTTTGGAAAC
TGTCCAGTAGATCCGACCACTTAGTCTTGGTCGATCTACTCAGCTGCCTATACCAATTCTTCGCTGGGCCGATCATCAGATTCGCGAAGGTGATACATTT
TTCCTCCTCTGTGGCTTGATCTCGCTGGAACGCGGACTTGACCTTGCTGATCCAGGACCGTGCTCGATCTTCGTCGAGATCCTTGCCGGCGAACTCTTTC
AGATCCGAGATCGCCGAGATCCTGACTCTCTGGATCACCGATGATCCTCCTTGTCCGATCGCGGCCGATGCCACAGCTGCCGGGATCGTTGTCCTCCTCG
CAGAACTCGGGATCCCGAGATCGTCGGGATCATACTCCCAAGAGTGTTGATCAGGAGTTCCGACGGACTCCATGTCGATATCCTGCGCCCCCAAGTATTT
TGGGCTGCTGATCAGCTTGGTCGGCGTGAAACTTTGCTCCCTCAGGAACCGGTTCATGACCATCTGGAAGTATTCGTCCAACTTGTTGCTAGATCCGGAC
ATGTTCGTCGTCGGGGTAGTCGGATCGACCGTGATCCCGTGGCTTTTTCGTAAATCGGGCGATCTAGCGAGAGATCGCGGTCCAGAAGGTCGTGGATCTT
GCTTCTTCGTGCGTGTTCTTAGCAATTTGGCTCCTGAAGGACCCAGAGACATCCGCTGGACTCCTCGCGAGCTGTCCGTATCTGGTTCTGATGTCGCGGA
CGCGTAGTGCGATGATCCTGTCTGGTAGCCGGGGTCAGGTATCTGTGATCGCTCGCCGACCAAGGTCTTGAGAGCGCTGAAGAGATCTCGGGTCGCAGAC
TGGATCGCGCTCAGATCCATGTCGAACAGGGAGTTCGGGTCGAAGTCACCGGCCACTAAGCCTGCCTCTCGAAGTAGATTCATGAGGATCTTCACTGCGA
TCAGGCGGTCGGTAGCTGATTGTGGATTCGATACCGGTCCCGTTAGATCTCCGATCTGGCGAACTTGTATGACCGCGAGAACGGGATCTTGTAGCAGAAT
CTCACTGAGCACCTTCCGGTAGTACGTCTACTCAATCGTGTCTTTGGTAGCGGTAACTCGCGACTTGGTcgcatcttcgacttccgAATCTGAAGCTTTC
AGCTTGGTCCGGGTACTCTtagtcttcttcttctttaccGATCTGGATGCGACCGCGGGTTTTGCGAGCAGATCAGGTTTCGGCTTCGCCGATTCCTTAT
CGCTCGGGTGCGGATCTCGATTTTCATCGAGATCCACAATGGCCCCCGAAGGGGCTGTGGGAGGAATTCGAGGCTTTTCTTCTAGATCTGGATCGTGATC
CAGGTCCGCCTCGTGTCCGCCAGTAGAGATCCTCCCAGAACTCTGCTGATCCGTGGATCTTGTCATATTCAGCGCTGTCTTCGACGATCCA