Description :
From Genome Similarity Track
Location :
Scaffold_2063:1451- 2784
Transcript NameFunction/comments
Phypl_g14622hypothetical protein

Sequence
1333 bases(100 bases per row)
GTGGATTTCGTCTCGGAGCAAGGATTTCGTTCGACGAAGGCACGGTTCCGATGCGCCACTGCCGGAACCCAATGCGCCAGTTCATGCCGATGAAGCCAAA
CAAGTGGGGGACGAAGTTTTACCTGACGTGTTACGCAGAAACTGCGTACTGTTCCAGGTACGAAGCACTCCAAATACGGATATCCGTCTCTCATGGCGGA
TATCCGTTATTTGATACAACGGACCATCCGTAACACGTTCCGCCTGAGACGGTTTATCTTCAGGTTATCACTAACAGCGCGGTTCTCTGCTTCGTATAGG
CTCGATATTTACTGCGGCAAAGCcaacgacgatgaagaagctgtcgcgCAGAAAGCAGTAGTCAAGAACCTTACACAAGTCTATCGGGGGCAGCCTTCTC
AGCGTCGCATCTGCACGGACAACTTCTACACGTCTATGCCGCTGTCACACAAGTTGCTTAGCATGGGTCATTACCATGTTGGGACTATCCGGAAAAACCG
CAAGGGCTGGTGTCTCGGCATAGAGTTCAAGTAGAAGACAAGACCGAAACGTATGCCCCGGGGAACCTACCGAATTGCAGTGTGGAGAGGGCATCCTGAG
TACGTGGCGCTGACCTGGATGGACAACAGGCCGGTGAGATTTCTAGCTACGGGGTGCGCTACGCAACTGGCTCAAGTTTCGCGCAGAGAGCGCGATGGAT
CCCTTTCAACGGTGCCTTGCCCTCAGCTTGTTCGTGACTATCATGAGTCAATGGGAGGAGTAGATGTGCATGATCAGCTACGTCTACAGCGTTATTCGAT
CCAGAGGGCCATTCGGATGAGGAAGTATTACAGAACTATCTTCCTGGGTGTCGTAGACATAGCAATGGTGAACGCGTTCATCATTCACAAGCTAGCCCTG
CAACGACGCAACAAGCCNCAATGGTGAACGCGTTCATCATTCACAAGCTAGCTCTGCAACGACGCAACAAGCCTGTACCGACCCATGCCGCGTTCATGCG
ACGGATGCACACAGATCTCCTAAGCCAAGGTAGTGAAGACTTTCCAGGTGATGATGACATGGCAGACTTGGTGACGGAGCCGCTTCCCCAGCGGGAGCAC
ACGCTAgagaagacggaggagatgaaCGGGGCgaagcggcggcagtggctCTGCAAGGTGTGCTCAGCCtacgcaggtgctggcgtccgcAGCTTCGAGA
CTAGCTACTTCTGCGCCACGTGCTCGCGGGCCAAGAAGGGAAGAGTGACTCTGTGCAACAAGGCccgacgactgcagcacggcaGCGCTCTTACCTGCAA
CGAGGTGTGGCACCAGAGCTGGAAGAATGGCAC