Description :
From Genome Similarity Track
Location :
Scaffold_14:145061- 146554
Transcript NameFunction/comments
Hyaar_Emoy2802605hypothetical protein
Hyaar_Emoy2802606hypothetical protein
Hyaar_Emoy2802607hypothetical protein

Sequence
1493 bases(100 bases per row)
CCGCGCTGCGTCGTCGTCTCCTTGAAGCTCATACTGCAATTTGCGTCCAAACGTTCACAAACACAAAGCACTTTAACCAGAATGGTGTCCTCCCCGCTCC
CCCCGTCGTCTCTGGACGCCCTCGCGCCCCCTTTCTACCCGTCCATGTCCTGGTCCCCAGAGATCACGGACGACTACTACCTGGAACGTCCGCACTCGCC
TGGCAAAGCTGGGTTCGTGATTGCGAGTCCAGTGGAGCCTGTCCAGGAAGTGCCGGACGAAGAGCTCTTTGATCCTGCCTTCTACCCGCTGTCAGAGACG
GAGATGCAAGAGCTGGAGCAAGTGGACGAAGTGAATGAGATTCTGGCAGAGCTGGAGTTGATGGAGAGCCACCAGGAGCTCCTTTTTAAACTGAGTGAGA
AGACGCGCGAGCTTCGCTCGAGTGCTAACGTGGATGCTGAGATGTACAACTGGATGGCCAAGTCTTCGCAACATGTTGATGTGTCGAAGAAGAGTGCGTT
CCACGTCAAGCGCAACGTGCGGTCGACGCTCCACCAGCCCCGTTCGGTCAAATAGAGCGCTTGGACGTTGATTTTAATTGACGTGCGGCGGCCCCTGTTT
GGACGCAACAGAGTGAGTGAGTGAGCAATTGGACGATGTGCGGTTCTTTGACACGCACGTCCTTTGGAATGAAGAAACGAAACGCGTGCTCCATCTGAGG
AAAAAAAGAGAGACAACAACAAGGACGACTCAGCGAGCCAGAGCTCCAGAGTTTCTGGTGGCACTGAGACGGCTTTTAACGACCGTGAACGACTCGTGCT
GTGGAAGGAAAATAGCAAGTAGTAATAAGGCGGATTGAAAAAGAGTGATGTCGGCGAAGAGAGAGAGCTGATGACATGGAGATGATCAAGAGCGAGCGAG
CGGCACGACGAAGGGACTGGATTGGAGCTTTGAGGACACGGGTGACAGCTGAAAGAAGGCTGGTCAGTGTGAACTTAAAGCTTGTGGGGATCGTCCTTTT
TGCGTGATCCGTGAATGCAGCGTTCAATGTGAATCAAGCAGTACGAGGTGTACAATTATCCCGAGAAAAAACGTAATACAATGTACGATGGAGCAACGTT
TTTCAAACTTGATACTGCAGTGTGTTTGTGTATCGTTAGAGACTTCGGCGCTCGAGAGGAGACCGATGCAGTGACATATTTGACATCGTGTGTCGGTCCT
GGTTCCCGCAGCTTATTGTACTGGACCGCTTGCGAGCAAGCGCTTGCCGGTCTTCCGAGCTCAAGTTTCGGACACGCTCGAGATTGACTTCGTCGGCATA
GCTTCTCATCGCGGCTTCGTTGTCTAGAAAGCTATCCCGCAGTGCATGGTCCCCTGAAATGCTGGTCGTCGCTGGCTGTGATGGAAAGCCGAAAAGACTC
ACTCGACGTTTGCGTAGCTGATCGACTCTAGCAGCAAGACGAAGCTTGAGCAAACTCATGAATTGCGTTAATGCGTCTGGTGCCATGGCAAAT