Description :
From Genome Similarity Track
Location :
contig_16:145017- 146567
Transcript NameFunction/comments
g4409.t1XP_009519973.1 hypothetical protein PHYSODRAFT_424253, partial [Phytophthora sojae

Sequence
1550 bases(100 bases per row)
CCGTACTTAAGAACAACCCAGAAACAAGCCCCGTTTTAAGACTTGAACTGAACGAAGACGGGTGGGCATGGAGAATCGTGTGGACAGCAGCATCACACAC
CAATTCTAAGGATCACAAGGAACTGTTAGCTTGGCAACGAGTTGTTGGGCTAGTTTTCGAAGCAGACCCACAAACAGCATTGCACCCGTGGTCAACGAAC
AAGACAACCATTGCGAAAAACATTCCAGCAAACTTGCGACGGCAACGATCAAAAACACTTCCGCAAAACTCAAGATTTACAGCTACAACCGATCATTGAC
ATGATCATGACCAGAGCAGGAAACTCAATCTGGGGAGGAGCGGCTCTTACACAGAAGCCCTAGCGACCTATGGGACCGACACGGACTTTTCACAGACTTT
CAGAACTGGACACTCTATAGAGTGGCAATCGGAGCAATCAATCTCTGGCACACTGAACGAGAAATCGACCAAAGCTGTCAACGAGAAGGCTGCACAGCCA
CCTATGAGACGATCGACCACATAGTTTGGGAATGTGCACATGCTCAAGCAGCATGGGCACAATGGATCGACAAATGGACTGGAACAACAACCAGCACCGA
CAGACGACAAGAATTAGAAGAGGCAATAGCGTCAAGGACAGCCCCCCTATTACGACAGAATTTCTAGCAGTAGCTGTAATGGGTCTGCTTAGACCGACTA
CTTGAGCTTACACGTGTGCGCACGTATATGAGGAAGCGTAGGTGTATTTAGCTTAATTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAA
TGAACCGAACGATAGCTTTGGTGCCACATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGG
ATGGCTGGCAGAACCCCTATCTATTGAATGGCTCTCATTGGTAGAAAGATGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTG
TGGAGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTATGAGGTGATCCGAATGTGTAGCCCCGCTACAGTCATCCAGCGGTTCCGAATC
AACGATCGGAGGCGTTTCGGCCCGGGGCACAGACTCCTTCTGGTCAGCCGTCATTTCGCTTCGTGTTGCCTGCTCAATCGGTGGAGATTCTCTCGCGTCC
TGATCGCTGGTATCACCTTCCTGATCTCTTGGGGATCCCTCAGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCG
AGGTTTCGCGGTCACGACGCAAGATTTTCATCGGTGCGTCGTACTGAGGTCGATCTACCATGGGTCCGGCAGGAGCGAGTTCGCGTTCTTCTACCTCCAC
ATAGTCTGTAGTGGACTGGAAGCCAGATTCTGCCACTCGGCATACCTGCGCGACCCAAGTAACACGAAACCGGGAGTACGAGGTACGCGTCCTCCTTCGA
GCCACATGCTGACCGGGTGTCGTCTTGCAATACTAACTTCTGATCGCTGA