Description :
From Genome Similarity Track
Location :
Scaffold_46:145014- 146472
Transcript NameFunction/comments
Aphas_H257_13074Hypothetical protein

Sequence
1458 bases(100 bases per row)
GCCAAGCAGCTCGCCGTGCCAACGTCCAAGGTCGTGTTGGTCGGCAAACGCGTGTTTGGGGAGCTCAAAGCTGCCAAACAAATGGGGCTCATCACCGTTC
GCATGGTTTGCCGTTTGAAACCAATCCTCCGCGAGAGTTTATAACGAGAATGTCCGTTAGATGTACGGAAAGTATGCCAAGACCATGCCCGTGGACGACC
TGGAACAACCCCATTACCAGGTGAATGTACATAGATGCATGCATCTTCACGATTGGTGTAGATGTCCAACTTGGACCAACTGCCTGCCATACTCGTGCTG
GCTGAAGGCCGGCGCCCGCGTCCGCATATTGTCGCACTCGGCGGCGGCACGGGTCTCGCAGTGCTGCTCAAGGCGTTGCGTGAGTATCCGGCCGACTTGA
CTGCCATTGTCACTGGTAAAAGATGCTATTTTTCTACATGTATAATTGTTGATGGACCGAACACATCGATGCCTAGTGTTTGACTCGGGGCGACATTCCG
GGGCGCTGCGGAAAACGCTGGGAATATTACCCCCCGGAGACATTCGCAACTGCCTCGTCGCGCTGTCCGATTCCGGTTGGCTTCGTTTTATCTTGTACAA
CAATCAATTACATGATGATGATGATTATGTGTTAGATCAATTGCTGCATCAGTTGATGAATTACCGGTTCCAGGACCACTACCTCGAAGGCGCGAGCCTC
GGCAACCTCCTCCTTGCCGCGCTCACCGACATCCACGGCGGCAGCTTTGACCAAGCCGTTGCGTCCATCTCGGACATCCTCAACATCCGTGGCCAAGTGC
TGCCTGCAACGCTGGACCAGTCGGAGCTCTGTGCGGTCCTCGCTGACGGCTCCACGGTCGTATCCGAAGTGAACGTGCGGAGCCCAGACAAGGCAGCGCC
GATCCGCCATGTGTTTTTAGAGAACGCGTCCGTCACTGCGTACCCCGCCGCGATTGCCGCGATCGAAGCGGCCGACATCATTCTCATCAGTCCGGGAGGG
TTTTACACGTCGATCATCGCCACGTTGCTCGTGCCAGGCAAGCAACAACGATTACAACAAGAGTTTGAATTGACGAATGTGGCTAGGCATCAAAGAAGCC
ATCGCAAAGGCTCGTGGCGCCGTCGTGTATATTAGCAACGTGGCGACGCAGACGGGCCAGTCGGACGGGTACACGCTGCCCCAGACCCTGTCGATCTTGG
CCGAGTACTTGGGCGACGACGTGGTGGACTATGTGATTGCCAACAATGCGATTCCGTCCACGCTGCCATTTGAACACGGCGAGACGCTGCTGCTGCCGAC
ACGGGACATGGAAGCAGCCGAGCGACCGATCCTCGTGCAAGGCCGCGCGTTCACCGACATGTCTGCGTTCGACGTCGAGTGGAAAAAGGTGCCGATGATC
AAGCACAATGGCGAAATGGTGCTGTCCATGCTCTACCGCATCATCGAAAAGGAAATGG