Description :
From Genome Similarity Track
Location :
Scaffold_14:14498- 16063
Transcript NameFunction/comments
Physo_258822Amino Acid/Auxin Permease (AAAP) Family

Sequence
1565 bases(100 bases per row)
CGCGCAAAACAAAACTCTCGAGAGTAACTATTCAAGGATCACACAAAAGACCTTTGTTCATCGGTACCGCTTAATTTTCGTGCGCGGCGGTGTAGTTGTA
GTACACAGTGTTCTCGTACTCGGGTCCGCAAAAGGAAATTCTACATCGCCGTCGCTGGGGTAAAACAAGTTCTGTCCCGACGTGTACGTCACGTAGCAGC
CCAGGCAGAAGCACACCACGGTGACAATAATCACTGCCATAGTCTTCTCCCAAATCGGCATCACCTGCCATTGCTGGGCAGAATGATGGAGTGCATTGTG
ATGCACGACGCCCCGACGAAGTTGGACAAATCTGAGAGATGGCCTTTGAGGATCACCGACGCAACCACTAGGATCGCGACGATCGCGACTCGTAGAAGAA
CGTACTTGATAGCGTTCGCGCCGCGGTATTCGGCAGCTTCGGCCTCGGGTTCTCCAAGGTGGGCGTTCTCGTTGTCAGCCATGTAAATAAAGGAGCGCTT
CGAGAGGCGGGATCTGTCCATGTGATCTGCAGCTTCGTTCGGTGTCGTCGCCTCAGCGTAGCTTGGCAGATTGTTCTCCACATCCTCGGGCGTTCGGGTA
TGCATCCCCAGAAAGAGACGCTCGGTAGTGTAGAACGCTGGATTCACGATGACGGAGAAGGCGATCGTAATGTGCACCTGCATGCACAGGTACGCCAGAA
CGACGGCACCCCAGTTCGAAGCGAAGCCCAGTGTGGTAAGGCCGGTATCCGACTGCGGGTAAATCGACCAAAGCAGATTACCAGTGATCTGGCAACCAAC
GGACGAGTACGCCGTGCTGGCCAGCACCAGGAAGCAGCACGTGATAAAAGCCATCGTCACGAACACGACACGTGGCATTCGAGCGGGGTCGCTGTGTTGG
CGTTGGAGAGCTGGGATGACGATGCCAGCGCCGTATGCAAGCGCCAGGTTGCCGAATGCGCCGGCGACTTGTTTGAAGTTGAGGTCAGGACTAGGAGCTG
TGGGATGACCACACATGCCGTACATGACAACTGCGATACCGATGATGTCCGCGACGAGCGTCCCCATGCAGCCTGCGAACGCAACACCCGCGCCTTCCTT
GAGGGTTGGCACGAGGCACACTGGCAACACCAGCAACGCCATGAGAACGGACCACATCGTTGTGCTGAAGGCGCCAGGGAAGAGGCCGTCCAGCAGCGTC
CCGCCGAGCACCAGGAAGACGCACGGCACGATCAGGCAGTTGCCCATTTGAGCTGTGACGGTGAGGTAGCGCCCCCATTTGCCCATGACCCACTCGCCCA
GATCACCGTACGTCTTGACGGACGTAGGCGCGAGCAGCGCAGATAGCGACTGCGCCGTAGATGTTGGCGAAGGCCATAAAGGTCATGGCGACGATCGCCA
GCGCAGGGCCGGCACGGGAAAAGTTTCCGGGCATTCCGAGAGTGTCAATGCCGTAGACGCAGCAGAAGGAGGCCTTGGCATCCTCCATGGTGAAGAAGGG
CTTGCCCATCGTGGAGACGCTGCTGCCGGGTCGCTTGGGTAGGAGGCGGAAAATTCAAGACTGAG