Description :
From Genome Similarity Track
Location :
Scaffold_15:144966- 147063
Transcript NameFunction/comments
Physo_357828alcohol dehydrogenase, putative
Physo_534582protein kinase, putative
Physo_534746Hypothetical protein

Sequence
2097 bases(100 bases per row)
AGATTTCGCCTCGCAGAGCTCACGCGCAGATGTTTGGAATTATTATCGTTGCGGTTCTGCTCGGGCGAGCAGCAGCGACTGTCGACTTGCTGGCGACGAG
TTACTTCGTTGATGAGAACTGCATGAACACGCCTCAAATCGTGACCATGGACTTCACGTACGACACTGCCGCCGCCGCAGCGTACATCGCTCCGACCGCC
GTCCAGTCTGCAGGCATTTTGACGCGGCGCTTGGCCGAGTCGACCTTGACGACCGAGACGAGCGTGACTGCCGTGTCGAGCTGCGTATCTGACGCCAGCT
GCACGCCAGAAGTCTACGGTGGGAACACGTACTACAGCAAAAGCGAGTGCATCACCGACCCGTACACGTACTCAGTCGAGATCTTCAATGGAAATGGCGG
AGTACTGCAGCCATTTCTGATGGTCGAGACGTACACGGGTGAGGATTGCGAGACGCTGAGCACCATCAACGCCACGGCCACGGCTAATGGCTGTCAATTT
GCTTCCGAGAACTCGTCGTCCAGCGCTACGTTGTTCACGAATGGCTCCGCGTTGTATCAACTGTACGATAATGGAGCGTGTGGCGGCAATGCCACTCGGT
ATTTCGTCGACAGGGCGACACTGTTGAATCACACGTGTTACGGAGGCAATACCAAGTTCTACACCAACTACGACGCCAGCACAAGCAGCAACAGCGCAAG
TGCAAGTGGAAGTGAAAGTACAAGTACAAGTTCAAGTGGTAGCAACTCGAGTGTTGCTAATACCGATGCGAGTATGCTTGGTGTTATTGACACTCCGTCG
CCGACATCAATAACTTCAACTGGGCATTCAGGGCTCACTGCAGGTGCCATCGTCGGTATCATCATCGGGTCGGTAGCTCTCGTCTTCTTCGTGGCTGCTG
TGGTCTTCTGGCGTTCAAGACTTTCCAGTTCAAAAGATACCGAAGACACGTACGCCGACTATCGCGCGGCTACAAATGGTCGGCCCACGATGTCTAGCGA
CCCCAACTCACAAGACATTGCACCACACGGTCTCGGGGGTTTGTGGGACGATGAAGTCATTGCCACGGCGCGGATCCCTCGAGAGAAGGTGGTCGTTCAG
CATTTGCTCAGTCGAGGAGCTTATGGAGAAGTCTACGCTGGACTGTACAATGGTCAACTCGTAGCGATCAAAATGTTACTGCAAGAAAACCGAAGAAGCG
TCCGGCATCTCAACGAGTTCCTAGCCGAGGTGAAGAGAACCGCACTGCTGGATCATCCACGGATTGTGCGACTTGTTGGTGTGGCCTGGGACTCCTTGAC
AGATCTTTGTGGTGTCTTGGAGTACATGGAGGGCGGTGACCTAAGAGCTTTGCTCGATAAACTCAATGTTCAAGGGCACCACAAGGGCTTCGACCAGGAG
AAGGTGAGGATCGCCCTTCACGTCGCCCACGCGCTCACCTACTTGCATTCGTTGGACTTGCCCGTGATCCACCGCGACTTGAAGTCCAAGAACATTTTGC
TAAGTGAAGATTTGGATGCAAAACTCACGGACTTTGGCGTCTCGCGCGAGCGGATCAACGAGACAATGACCGCAGGTGTGGGGACGTCGTTGTGGATGGC
TCCAGAAGTTATGATGGGGGAGAAATACGATGCCAAAGCCGACATATTCTCGTTCGGGGTGGTGTTATCCGAGTTGGACACGCATTGCCTACCATACGAC
AACGCAAGGAAGAAGACGAATAAATCCGACGCGGCGATTCTGCAATTGGTAGCGGCTGGAAAAATCCACGTTGAGTTCTCGCCTTGGGCGCTTCAGTCGA
TGGTGAATCTAGGACTTGCTTGCGTATCGGTAGACAGCAAACTCCGCCCCACAGCAGCCGAGGCGCTGTACAAACTCCACACAATCCTATCTCAAGAAGT
CTAACCAGGGAGACGGCGTTGATGTGAGACGAAGGCAAACGCGAGAACGTGGTGGAAGAAGAATTATTGAAACTTGAAAGCCTGCGTGAGACCGAAGCGA
AGGAAAAGAAGACCAAGAAGCTATGCGACGACCTGCGCGCTCCACTCCTCACGCTACTCCGCGGCTGCGATGGATGGAGCCTACCTCTCCTGGCGAG