Description :
From Genome Similarity Track
Location :
Scaffold_260:14495- 16646
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_260-snap-gene-0.14Myosin

Sequence
2151 bases(100 bases per row)
ACTTGTCGGAGCTCTCGCTGCTCGAGAACCTGCGCAAGCGCTACGAGAACAACCTCATCTACACGTACGTGGGTCCGATCCTGATCGCCATCAACCCGTA
CAAGAAGCTGGACTTTGGCGAGCGCCGCATGGCCGAGTACTTTGGCAAGGCCATGGGGCTGTTGCCGCCGCACGTGTTTGCGCTGGCCGACCACGCCTAC
ACGCAGCTCATCAGCGGCGGCGCGCTCGACCCAGCCAACCAGAGTATCATCATTAGCGGTGAGAGCGGCGCCGGCAAGACCGAGACCACCAAGATCATCA
TGCAGTACCTGGCGCGCGCCACGAGCTATCGCAAGTCCCCCGGCGACGGCGACAACGTCCCCACCACGCGCCTCTCGGGCGGCGACGCGAACGGCAGCGN
NNNNNNNNNNGCTTGGACGCCTGGAGGAGCGCGTGCTGGACTCGAACCCGCTGCTCGAGTCGTTTGGCAACGCCAAGACGCTGCGCAACGACAACTCGAG
TCGCTTCGGCAAGTTCATCGAGATCCAGTTCGACCACCACGGCAAGATCGTCGGCGCCGAGATCATGAACTTCTTGCTTGAGAAGACGCGCATCGTCTCG
CAGAGCCTCGGCGAGCGGAACTACCATATTTTCTACCAGGTATGCAACAATGGTTTTGGTGTGTGAGCGAGATGCAAGGCGATGGTTCTCACTGACGTGT
ATCTGTGTCGTGCGCTGCAGCTTCTTGCAGGAGCTGACAACGACTTGCGCCAGAAACTTCAACTGCGAACGCCGCAAGATTATGAATACCTGCGCAAGAG
TCAATGCTTCACGCGTCCATCATGGTATGTCCCCTTTGTTTAGTGATGGATGCTGGTATACTCTGTAGCTTGATGTTGACGCGGCGTGCGTGCATTTGTG
TTGCAGTGATGACGCGGAGGAGTTTGCGACCACCAGGCAGTGCATGTCCAGCATCGGCATTGACGAGCAACGACAACGAAAAGTGTTTGAGCTGCTCGCG
GCGGTCTTGCACGTTGGAAACCTTGAGTTTGGTGTCGAGAACGACACGAGCGTGATTGTTGGCGAAGAGAAAGAAGCCACCCTTGATATTGTTGCGACCC
TGCTGCAAGTGAGCGTGGACTCGTTGCAGCGCGCGCTTGTCACGCGCCAGCTTCACGTCGGTGGCAAGGTGATTGTTCAGCAGCAGAATGTTGAGCAGGT
GCGCGACAAGCGAGACGCGCTGGCGAAGTCGATCTTCTCGTCTCTGTTTTTGTGGCTCGTCAAGGAGCTCAACCGAACGATTTCTCGACCGCAAGACAAG
TGGGGTTTCATTGGTGTGCTGGATATCTACGGCTTTGAGAAGTTCGAGTGGAACACCTTTGAGCAGCTGTGCATCAACTATGCCAACGAGAAGCTGCAGC
GTCATTTCAATCAGCACATGCTGGAAGTGGAGCAGGAGGAGTACACGAAGGAGGGCATCGACTGGAAACACATTGAATTCAGCGACAACCAGCAATGTCT
CGACTTGATTGAAAGCAAGGTGAACGGCAAGCCGGGCATTTTCATTACTCTGGACGATCAGTGGCGGTTGAAGGGCGACGAGGCCAACAAGAAGTTTGTT
TCGTCGCTCCACGCTGCGTTTGGTCGCAACTCGACTGCTGGGAGGACGCAGAACGAATGGTATGTGCATCCCAAGGTCGATGCGAATCTGAGTTTCGGTA
TCAAGCACTATGCGGGCGAGGTCATCTACGACGCGAGCGGCTTCAACGACAAGAACAACGAGACGTTGAACGACGACATGAAGGAGCTCATTCGTCAGTC
CCGTAATGACTGGCTCCAGAGCATCTTCAACCTTAGTGTTCAGTCCATTGAGGCCATCCCTGGCGTCAACACCAAGCGTCCGCAAGAAACCTTTTCTCGG
CGGCCGTCGGAGTTGAAAGGTCACGGCGGCGGTCATGGTGGCGGCGGTAGCAAGTCTCGAAATCTCCGGGAAGTCTCGGTCAGTGCTCAGTTCCGGTTCC
AGCTGCAGGAGCTAATGGCGAAGATCTCGCTGGCGAACCCGCGGTATGTCCGGTGTATTAAGCCCAACGAGTTCAAGCGTCCGAGTGAGCTGAACGATGC
CGACTGCGCTCGGCAGCTCAAATATTCTGGGATGATGGAGGCCATTCAGAT